Clone Read LE_HBa0032H01_T7_140486

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0032H01_T7_140486
Primer
T7
ID from Seq. Facility
LE_HBa_032_H01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
658 trimmed for vector and quality, 847 raw
Genbank Accession
Sequence
>LE_HBa0032H01_T7_140486 (raw untrimmed)
TGCGGTACCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAACGCTTACCAAGATGCATCATTCCACTTTTCACTTGATAATTATTTCTACA
AGCATGGTTTAATATATGTAGAATTCATATCCTCATAATCTTTTACAATATTGCGCGCTATTGTATCAAAGATATCGTCAACGATATACCATTTTGTATC
GATTCACAATACGACAAAACTTATTGAGATCTCATCACTTCATTATTTTTAGGTAGCTATCCCTCTCATGAAGTTTCATAAAGTGTTATGTCGTAGGCTT
TCCAAGAGCACATTGCCTCCTTATTATGATCATTTTGATTCTTTGATCCTCTCCCTTTTTCAAGGATTATTTTATTTAGAATTGATTAGTCTATCATGCT
TCATGTATGTCATAGACTTTATCCTTAAGGGACATTCAATAGGAGTATTTAGAACTTTTGTGTTGCTTCTAATTTCCCCCTTATGTTAGACAACCTAACA
TATATCTAAATCTTTTGGAGAATCTATCTTTGTGCATCATAGTATATTCATTAATCATATATTGCACATCAAAACTATCAGATGAAAACTATTTGGTCCC
TGACCATAAACCAATTAACAGAAAAATTGATCCATAACTTATGGTTTTGATTCATACAATTATGTTTGTATGTAATAACATATTTTACATCAACACATGA
AAACTTATTTTCATAACCAATGATTTACTCTGGTGAGAACTTTTAGTGTCCCCCTCTCTTGACGATTTTATCATTCTTTCCTAAAAAAATTGGTTTTAAT
TACCAATTTTCTGAAAATATGGGGCTGATACTTCAAAAAATTTTTGC
>LE_HBa0032H01_T7_140486 (trimmed for quality and cloning vector)
AGCTTAACGCTTACCAAGATGCATCATTCCACTTTTCACTTGATAATTATTTCTACAAGCATGGTTTAATATATGTAGAATTCATATCCTCATAATCTTT
TACAATATTGCGCGCTATTGTATCAAAGATATCGTCAACGATATACCATTTTGTATCGATTCACAATACGACAAAACTTATTGAGATCTCATCACTTCAT
TATTTTTAGGTAGCTATCCCTCTCATGAAGTTTCATAAAGTGTTATGTCGTAGGCTTTCCAAGAGCACATTGCCTCCTTATTATGATCATTTTGATTCTT
TGATCCTCTCCCTTTTTCAAGGATTATTTTATTTAGAATTGATTAGTCTATCATGCTTCATGTATGTCATAGACTTTATCCTTAAGGGACATTCAATAGG
AGTATTTAGAACTTTTGTGTTGCTTCTAATTTCCCCCTTATGTTAGACAACCTAACATATATCTAAATCTTTTGGAGAATCTATCTTTGTGCATCATAGT
ATATTCATTAATCATATATTGCACATCAAAACTATCAGATGAAAACTATTTGGTCCCTGACCATAAACCAATTAACAGAAAAATTGATCCATAACTTATG
GTTTTGATTCATACAATTATGTTTGTATGTAATAACATATTTTACATCAACACATGAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.92982
Expected error %
1.0576
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0032H01
Clone
Clone name
hba-32h1
LE_HBa0032H01
C01HBa0032H01
P032H01
Clone type
BAC
Contamination
none
Estimated length
133,679
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found