Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0035A11_SP6_140937

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0035A11_SP6_140937
Primer
SP6
ID from Seq. Facility
LE_HBa_035_A11-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
663 trimmed for vector and quality, 912 raw
Genbank Accession
Sequence
>LE_HBa0035A11_SP6_140937 (raw untrimmed)
CCAACGGCTGCTACAGATTTCGTACAGCAGTTTGGAAGGGAATAGCCTTTCGAGTATTGAGAATGAGAATGTTGGAAACATTGTCTATAGTAAGTGAAAC
CTGTTTTATTGATTTCTTAGGTAGGATCAATTACTTTCTAAAAAGTTTTCAGAACTCACTCACCTTTTTTTCTTATCTTCTGAATTTTATTTGAGCGTTT
GGGCAAATTCTCTGCTTCTCTTATCCATAGAATAGAAACTTGTTGAAACTGAGTCGTATTAGTATCTTCTGAGCATGTGACATTTCATATAAATACTGAA
TCTTCTTTGTTAATTATAAGGTCTGGATGTAGTTGCTCTGATTTGTGATATGAATATTTATCTCCTTCTCTTGCAGGTCTGTTTTGCCTGAAGAGAAAAA
ATACAGTCATGAGAGAACTTATTCTCCTCGTGGTGGCCAGGGAAGCTCATACTCACACATAAGGTTCCTTTATAGAGAATGAAATGGTTCGATCAACTTC
ATTTCTGATAGTTGACTCTTCAAATTCTTTTGCCAAACATAAGTATGATGGTTGAATACAGATTGCAGATGATAGACTCAAAAAACTCAAATTCTTTTCC
CATATTTAATGGGACAAGTTGAGTAGCTTTTAAGTAACTTGATCACTTTCATTGTGTCCCCCACAACAACTAAGAAGACATGGTGATATCCTAAAACGAA
CTATTGGAGGTTATCTTGTTGTTAACGGCAGAGCTGATGACACTATGAATCTTGGAGGCATAAAGGTACTACCACTTTAAGTTTGATGGTTTGAGTTGCT
AGTAACAACACTAAGAAGAAATTGGGCCTTCGGCGGCATGAAATGTTGTTTGTTTTTGTGGCGACAAGTTCAAAAAAATTGAACCTGTATGTAATGGTGC
TAAAAAGAGTTC
>LE_HBa0035A11_SP6_140937 (trimmed for quality and cloning vector)
AAGGGAATAGCCTTTCGAGTATTGAGAATGAGAATGTTGGAAACATTGTCTATAGTAAGTGAAACCTGTTTTATTGATTTCTTAGGTAGGATCAATTACT
TTCTAAAAAGTTTTCAGAACTCACTCACCTTTTTTTCTTATCTTCTGAATTTTATTTGAGCGTTTGGGCAAATTCTCTGCTTCTCTTATCCATAGAATAG
AAACTTGTTGAAACTGAGTCGTATTAGTATCTTCTGAGCATGTGACATTTCATATAAATACTGAATCTTCTTTGTTAATTATAAGGTCTGGATGTAGTTG
CTCTGATTTGTGATATGAATATTTATCTCCTTCTCTTGCAGGTCTGTTTTGCCTGAAGAGAAAAAATACAGTCATGAGAGAACTTATTCTCCTCGTGGTG
GCCAGGGAAGCTCATACTCACACATAAGGTTCCTTTATAGAGAATGAAATGGTTCGATCAACTTCATTTCTGATAGTTGACTCTTCAAATTCTTTTGCCA
AACATAAGTATGATGGTTGAATACAGATTGCAGATGATAGACTCAAAAAACTCAAATTCTTTTCCCATATTTAATGGGACAAGTTGAGTAGCTTTTAAGT
AACTTGATCACTTTCATTGTGTCCCCCACAACAACTAAGAAGACATGGTGATATCCTAAAACG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.941628
Expected error %
0.16
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0035A11
Clone
Clone name
hba-35a11
LE_HBa0035A11
P035A11
Clone type
BAC
Contamination
none
Estimated length
124,223
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found