Clone Read LE_HBa0035M19_SP6_141529

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0035M19_SP6_141529
Primer
SP6
ID from Seq. Facility
LE_HBa_035_M19-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
669 trimmed for vector and quality, 899 raw
Genbank Accession
Sequence
>LE_HBa0035M19_SP6_141529 (raw untrimmed)
CATTGGGCAAATTACAGCAGTACTTNCTGGAAGCATATTAAACAATACTGTGTCATTTTTGACAACCAAACACTTGAAAGATCGAATTAAGCATATAAAA
ATCATGTAGTATATATATATAGAGGTGGTGTTGGTCAATTGAAGAATATTGTGTCACATGAAGCAAAGTAACTGGCCCTCTTGCAAAACTTTATGTTATT
TTTATGTAGTCAAATTCATATGATGGAATTGAAGTGGAACCTTTTCATCTTCCTAAGATATGATTTTCTCTCTCGAAATTTCTTGTCTATTATTATACTC
TTCAAGATGCTTTTCACCACAAACTTTAGCCTTTTTATCATATAAATTAAAGTTAAGTCATTTCACTTCAAGTTATTTCATTAGGGTTAGACAGTTGGAA
TATTGAAGTTCCCACTACTTGATTGCAAAACAAAAAAGCACAACTAACATACTTTGTTATTTCGAATATGAAATAGAAGTAATGCATGAACCTACAAAAA
AAGATGTAAGATTTATAATTTGTCATATCCCTAATAGCAAATAGAAAGTGAAGAATGGTCCCCTAAAGGCATTTAGCTTTCCAATATTGAATAGGACATT
GTTATTTTTTTAAAAACAAAACTATAATAAGCGTTTGATCATGAATTTTTTTGTTTAATTTGTCATAAAAAAAAGTTGACTATCCAATTTAGCATACATA
CTTGTCAATGATGTTATAAACTCCACATGATCATCATTTAATTATCTTGGGCAAAGACGGATTCTATGTAACAGATACGAATGATCAAAACTCTTAATTT
TTTTTTTGAACCTCTTAATTATTTTAAAAAATACTTAAGGGATAAATTATTATTGATGGGAACCCCAAACTAAATGTTGTTGATTTTGTTCCTTAAGGA
>LE_HBa0035M19_SP6_141529 (trimmed for quality and cloning vector)
GAAGCATATTAAACAATACTGTGTCATTTTTGACAACCAAACACTTGAAAGATCGAATTAAGCATATAAAAATCATGTAGTATATATATATAGAGGTGGT
GTTGGTCAATTGAAGAATATTGTGTCACATGAAGCAAAGTAACTGGCCCTCTTGCAAAACTTTATGTTATTTTTATGTAGTCAAATTCATATGATGGAAT
TGAAGTGGAACCTTTTCATCTTCCTAAGATATGATTTTCTCTCTCGAAATTTCTTGTCTATTATTATACTCTTCAAGATGCTTTTCACCACAAACTTTAG
CCTTTTTATCATATAAATTAAAGTTAAGTCATTTCACTTCAAGTTATTTCATTAGGGTTAGACAGTTGGAATATTGAAGTTCCCACTACTTGATTGCAAA
ACAAAAAAGCACAACTAACATACTTTGTTATTTCGAATATGAAATAGAAGTAATGCATGAACCTACAAAAAAAGATGTAAGATTTATAATTTGTCATATC
CCTAATAGCAAATAGAAAGTGAAGAATGGTCCCCTAAAGGCATTTAGCTTTCCAATATTGAATAGGACATTGTTATTTTTTTAAAAACAAAACTATAATA
AGCGTTTGATCATGAATTTTTTTGTTTAATTTGTCATAAAAAAAAGTTGACTATCCAATTTAGCATACA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.924869
Expected error %
0.2341
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0035M19
Clone
Clone name
hba-35m19
LE_HBa0035M19
P035M19
Clone type
BAC
Contamination
none
Estimated length
60,347
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found