Notice: The contact form functionality has been restored. Apologies for any inconvenience.

Clone Read LE_HBa0035M19_T7_141530

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0035M19_T7_141530
Primer
T7
ID from Seq. Facility
LE_HBa_035_M19-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
741 trimmed for vector and quality, 896 raw
Genbank Accession
Sequence
>LE_HBa0035M19_T7_141530 (raw untrimmed)
CTAACCTGGGCCCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTGAGCTTTCTGTCTTATGTGATGCTGAAGTGGGATTGATTATATTTT
CTCCAAGAGGAAAACTATATGAATTTGCTAGTTCAAGGTAAGTAAATGCTACTATATTTCTTATTTTTAATTTTATCTATTATATAGGTGTTTGTTTTCG
TTCAGATCGTATCAGATCTCATATTTATATTATACATGGATAGAAAGTATTTAGATGTAGATGCAGATCCAAGTCCTTTTGATTACTACAGTAGTTCTTA
ATTATACTAATTTCTCAAGAGGTTGTACTTCATCCAGATATAATCCATTAAAAAACTTAACCCTAGTTAGTTCAAATATTCATTTGATTAAGAAAACAGT
AATTTTGTTCCTATAACCTTAAAAATGGAATAGTTGTATGGACCAAATTAAGTTTTTGTTGAGCAATTAGACAACATATAGAGTAGTAGTACTAGTTATA
TCCTCGCATAGTTAATTAATTTAGCATTATTCTTATACACTTTACGTAACGATCAACAAGAGTATAAATGGGAGCCAGTTGTCAAGTTATAGTACTAGTT
GATTTCATGATCTATATAAGTTCTTGGGCTGTTCCCATTATGAACAACACCTTAAAAGAATCTTTTGGACAGACAACAATCTATTTTCTGTACGGATACT
CTTGATATTCACATACCAAATTACTATGCCTTTTGTGCTTCCATTTATATATATATATATATTTCTGTCAGTAAAATCTTATTTTCTTTCTAATATATGA
ATTATCCATGTTTTACCCAAAATTTTTGACACCCTATAAAAGCATGCTTTCTTATTACAAACAAAATAAAATATTTTTAAGAGAATCTATTTTTGT
>LE_HBa0035M19_T7_141530 (trimmed for quality and cloning vector)
AGCTTTTGAGCTTTCTGTCTTATGTGATGCTGAAGTGGGATTGATTATATTTTCTCCAAGAGGAAAACTATATGAATTTGCTAGTTCAAGGTAAGTAAAT
GCTACTATATTTCTTATTTTTAATTTTATCTATTATATAGGTGTTTGTTTTCGTTCAGATCGTATCAGATCTCATATTTATATTATACATGGATAGAAAG
TATTTAGATGTAGATGCAGATCCAAGTCCTTTTGATTACTACAGTAGTTCTTAATTATACTAATTTCTCAAGAGGTTGTACTTCATCCAGATATAATCCA
TTAAAAAACTTAACCCTAGTTAGTTCAAATATTCATTTGATTAAGAAAACAGTAATTTTGTTCCTATAACCTTAAAAATGGAATAGTTGTATGGACCAAA
TTAAGTTTTTGTTGAGCAATTAGACAACATATAGAGTAGTAGTACTAGTTATATCCTCGCATAGTTAATTAATTTAGCATTATTCTTATACACTTTACGT
AACGATCAACAAGAGTATAAATGGGAGCCAGTTGTCAAGTTATAGTACTAGTTGATTTCATGATCTATATAAGTTCTTGGGCTGTTCCCATTATGAACAA
CACCTTAAAAGAATCTTTTGGACAGACAACAATCTATTTTCTGTACGGATACTCTTGATATTCACATACCAAATTACTATGCCTTTTGTGCTTCCATTTA
TATATATATATATATTTCTGTCAGTAAAATCTTATTTTCTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.924468
Expected error %
0.5878
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0035M19
Clone
Clone name
hba-35m19
LE_HBa0035M19
P035M19
Clone type
BAC
Contamination
none
Estimated length
60,347
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found