Clone Read LE_HBa0036B17_SP6_141765

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0036B17_SP6_141765
Primer
SP6
ID from Seq. Facility
LE_HBa_036_B17-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
556 trimmed for vector and quality, 926 raw
Genbank Accession
Sequence
>LE_HBa0036B17_SP6_141765 (raw untrimmed)
GGGGGTTGGTTTCGGGGTACATTACTTGGCTCGGTTTTATGGGGATCAGCAGGGCGAACACATCGTCACTGCGTCTTCTTCTGATTCTTCAATTTGCATT
CACGATGCTATTTTGCCAGCTAATCCCCCTAAAGTTCTTCGACAGCACAGAGATGGCGTCACCGCTTTGTCTCTCAGCCCTAATTACACCTGTCTAGCTT
CTGGATCTATTGACCATTCCGTCAAACTCTACAAATTTCCTGGTATTTTCTCTCACTTTTTTTCTCTCTCATAACAGGTAATTTATGTCCACAATGGAAA
TGGAAAGTAGAGTGATTTCAGTTTAGGAACAAGGAGTTCGTTTTAGTTCATTTAGTTTTTGCTTGTTGTGTTCCTGTTGTAGGCAAAATGAATAGTTAAT
CCTTAAGTTGACCGATGAAAGCATTGTGACACATTAGCCGCGGACCAAAAAAGGAAATTTATCTGACTTAGGGCTAATTTAGTAAGAGTTATAAGGGATA
ATGATGAATTTTAGGCTGAGTTTATCCCGTGTTTGGTTGTGATAAAATCACGTGATGACTTATCCCAATATTAATTATCCCGTGACAGTATTATTTTTAT
CCCACATTGGGAGTGGATAACAATACCTGCATCATGAATTCCGGAGATAACTTGTTCCCTTACCAATTGAGCCATTAAAGTTCACAATTGAATGCCACAT
GTATATTTCCAGAAATTGGCGCCCCTGCTATGGTAATCACATCTAGCCGTTTCCAAAGCAGGAGGTTCGGGAGAATGATCTGGGAAGGTATTCTTAAATG
GCTTAAAAAATCACATGTTATTATTATCGTATCTCCAAAGGGAGAGAATTTACAAAGTGTTTTGGTTTATTTTTTGTCAGGGTTTAAAACTCAAAAATAT
ATGTCGCTCCCACAAAAATCAAATAC
>LE_HBa0036B17_SP6_141765 (trimmed for quality and cloning vector)
GATCAGCAGGGCGAACACATCGTCACTGCGTCTTCTTCTGATTCTTCAATTTGCATTCACGATGCTATTTTGCCAGCTAATCCCCCTAAAGTTCTTCGAC
AGCACAGAGATGGCGTCACCGCTTTGTCTCTCAGCCCTAATTACACCTGTCTAGCTTCTGGATCTATTGACCATTCCGTCAAACTCTACAAATTTCCTGG
TATTTTCTCTCACTTTTTTTCTCTCTCATAACAGGTAATTTATGTCCACAATGGAAATGGAAAGTAGAGTGATTTCAGTTTAGGAACAAGGAGTTCGTTT
TAGTTCATTTAGTTTTTGCTTGTTGTGTTCCTGTTGTAGGCAAAATGAATAGTTAATCCTTAAGTTGACCGATGAAAGCATTGTGACACATTAGCCGCGG
ACCAAAAAAGGAAATTTATCTGACTTAGGGCTAATTTAGTAAGAGTTATAAGGGATAATGATGAATTTTAGGCTGAGTTTATCCCGTGTTTGGTTGTGAT
AAAATCACGTGATGACTTATCCCAATATTAATTATCCCGTGACAGTATTATTTTTA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.966277
Expected error %
0.2503
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g42660.1 Score 84 E Value 5e-17 Identity 20.70% Align. Length 197bp (35.43%) Frame 2
68416.m04436 transducin family protein / WD-40 repeat family protein contains 5 WD-40 repeats (PF00400); AND-1 protein - Homo sapiens, EMBL:AJ006266
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB86449.1| Score 84 E Value 2e-15 Identity 20.70% Align. Length 197bp (35.43%) Frame 2
putative protein [Arabidopsis thaliana] ref|NP_189852.1| transducin family protein / WD-40 repeat family protein [Arabidopsis thaliana] pir||T47324 hypothetical protein T12K4.110 - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0036B17
Clone
Clone name
hba-36b17
LE_HBa0036B17
C03HBa0036B17
P036B17
Clone type
BAC
Contamination
none
Estimated length
71,310
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found