Clone Read LE_HBa0036J15_SP6_142145

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0036J15_SP6_142145
Primer
SP6
ID from Seq. Facility
LE_HBa_036_J15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
595 trimmed for vector and quality, 971 raw
Genbank Accession
Sequence
>LE_HBa0036J15_SP6_142145 (raw untrimmed)
TTTAACCTAAATTTAAAGTTAGTTAACATTTCCTACCTCGATCGTTCTATAGATTGACTTGAAGATTCCAACATGCCTGAATAAACCACAAAAATTGAGA
AAAATTATTACTTTCAAACTGAATAAATCAGAAAAATTGAACCAAACTGACAATCATCAAACTGGTGGTTATTTTTCGTTTGGTTTAGTTCTAGAAACTT
AAAATACCGACTAGATTAATTTTGTTTTGATTTTAATCAATAAACGATCTAAATGAACTATGAACACCCCTAATTGTGATAAAAGATAAAAAAAAAAAAA
TTAACAAATGAAAGTTATAACGGAATGTTTATGATGATTTTTTCCATTAAATAAATTAAGAGCTATACAATTAATAAAGAGGGTTCGAGAAAGGATTTAA
TTCACTTGCAAACTACTGGATTTAAGTTTTCTTGACCATTTATAGACTATAGTCTTTTGGCATTTAATAGGTAACTACTTCTATTTTTACCTTTATCCTC
AGGTTGGACTATATTAAAAGCTGGGAAAAGGGTCTGATATACCCCTCAATTTTGTTATTTGGAGCTGATATACCCCTCGTTAAAAAAGTGGCTCATATAT
GTCCTTATCGTTATACAAACGGCTCACATGAATGCCCTTATTTTGTGATCATTTTTAAATTTTTATTTTTTTAATTCATTTTTTTTAAATATTTCCTTTT
AATTTATAAGCAACAAAATTTATCTTTAATATTAAAAAAAATACGCCTGACCCACAAATATTCACTAGGGCAAAAAATAATCATTCCCAACGTTTTATTT
TTTTGTGCTTGCAAAGGGTCTACCTTATTACTCCCTGGGGATGGAAGTTAAAATCAAGAAACTTGGCCCCCTAGGGGTACCCGTGGCAAATTTTTAATTC
CTAATTGGGGGCAAATTCTCCTCTAATAAAAACCTAAAAATACCCCAAGAAATTTGCTTAAAAGGTTCAAA
>LE_HBa0036J15_SP6_142145 (trimmed for quality and cloning vector)
TTGACTTGAAGATTCCAACATGCCTGAATAAACCACAAAAATTGAGAAAAATTATTACTTTCAAACTGAATAAATCAGAAAAATTGAACCAAACTGACAA
TCATCAAACTGGTGGTTATTTTTCGTTTGGTTTAGTTCTAGAAACTTAAAATACCGACTAGATTAATTTTGTTTTGATTTTAATCAATAAACGATCTAAA
TGAACTATGAACACCCCTAATTGTGATAAAAGATAAAAAAAAAAAAATTAACAAATGAAAGTTATAACGGAATGTTTATGATGATTTTTTCCATTAAATA
AATTAAGAGCTATACAATTAATAAAGAGGGTTCGAGAAAGGATTTAATTCACTTGCAAACTACTGGATTTAAGTTTTCTTGACCATTTATAGACTATAGT
CTTTTGGCATTTAATAGGTAACTACTTCTATTTTTACCTTTATCCTCAGGTTGGACTATATTAAAAGCTGGGAAAAGGGTCTGATATACCCCTCAATTTT
GTTATTTGGAGCTGATATACCCCTCGTTAAAAAAGTGGCTCATATATGTCCTTATCGTTATACAAACGGCTCACATGAATGCCCTTATTTTGTGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.919453
Expected error %
0.3407
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0036J15
Clone
Clone name
hba-36j15
LE_HBa0036J15
C06HBa0036J15
P036J15
Clone type
BAC
Contamination
none
Estimated length
109,512
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found