Clone Read LE_HBa0036O16_SP6_142387

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0036O16_SP6_142387
Primer
SP6
ID from Seq. Facility
LE_HBa_036_O16-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
613 trimmed for vector and quality, 910 raw
Genbank Accession
Sequence
>LE_HBa0036O16_SP6_142387 (raw untrimmed)
CCTTTTAATCGTTCCCCTCGTTGCTTATGATNGGAAACTGAAAATATTTGTCTCCTATGATAGCAGGTTAGTTAAAAGTCATTTTTTACAGGTACTACAT
TTATCAACATAATGAAAATACTTTCTTTTTGTTTTTATAGTTATTTCTATCGTTGAAGGCTATTGTGTTCATTTTTAGTTCCTAAAAAATGATGTAACTT
TCCTCTATTGATTTTGTCAGAATAACCACCTTAAATCGATAGAATCAAAAATTACAATACAAAATAACATTTACTAATTAAAAACCTCTGAAATCAAACC
TGTTTAGTAAAACTTATCTAGAAAGAAATGATGAGAATAATCCTTCTACAATATGCAAAGCTCGAAAAAGCTTTATGCTAATTTCAAATGACACTTAGTA
CTGTATAATATATACCCTGCACAAGTTATGTCATTATATATTTGGCTTATCATGACCCTATAAAATTGATCTAAACTCTGGAATAGGCTTTTGATCAAAC
ACTACTACTGGTATGTTACTTTTCAAAACTATAGTAATCTGCTGATTCTTTCACATTTTTCATCGCATTTTATTTGTACATCATACTATTTTTTCTTTCT
CTTAAGGGTTAAAATTTGGGTTGTGTTATTCTGTTTCCACCTCTTCATGATTTATCGAAACTTGAGATTTTTAATATCGTCGTCATATGTCCCTTTACTA
TCTGCTGATGATCAAATTTAAACTCTTGAACTGAATTTCCCCAAAAAAGTTTAAGGTAATATTAAAGATATTTCTAAATCCTTGTCCAGATTGATTAAAC
CTTTAAATTAATGTACAATATAAATAATTTCTTTTAAAAAATGAATCTTTATTTATATAAAAGGCTTATGCAATTGGAAATAGGGCTAAAAAAGAGGCTT
TTGAACCTAT
>LE_HBa0036O16_SP6_142387 (trimmed for quality and cloning vector)
GGAAACTGAAAATATTTGTCTCCTATGATAGCAGGTTAGTTAAAAGTCATTTTTTACAGGTACTACATTTATCAACATAATGAAAATACTTTCTTTTTGT
TTTTATAGTTATTTCTATCGTTGAAGGCTATTGTGTTCATTTTTAGTTCCTAAAAAATGATGTAACTTTCCTCTATTGATTTTGTCAGAATAACCACCTT
AAATCGATAGAATCAAAAATTACAATACAAAATAACATTTACTAATTAAAAACCTCTGAAATCAAACCTGTTTAGTAAAACTTATCTAGAAAGAAATGAT
GAGAATAATCCTTCTACAATATGCAAAGCTCGAAAAAGCTTTATGCTAATTTCAAATGACACTTAGTACTGTATAATATATACCCTGCACAAGTTATGTC
ATTATATATTTGGCTTATCATGACCCTATAAAATTGATCTAAACTCTGGAATAGGCTTTTGATCAAACACTACTACTGGTATGTTACTTTTCAAAACTAT
AGTAATCTGCTGATTCTTTCACATTTTTCATCGCATTTTATTTGTACATCATACTATTTTTTCTTTCTCTTAAGGGTTAAAATTTGGGTTGTGTTATTCT
GTTTCCACCTCTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.918383
Expected error %
0.3155
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0036O16
Clone
Clone name
hba-36o16
LE_HBa0036O16
P036O16
Clone type
BAC
Contamination
none
Estimated length
127,432
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found