Clone Read LE_HBa0169M14_SP6_14253

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0169M14_SP6_14253
Primer
SP6
ID from Seq. Facility
LE_HBa_169_M14-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
455 trimmed for vector and quality, 763 raw
Genbank Accession
Sequence
>LE_HBa0169M14_SP6_14253 (raw untrimmed)
GACCAACCCTTTTTTTAAGGGATTCTAGCATTTAGGACATAACCCAAACAAACTCTTTATGCATCACAATACACCACAAAACCTTGTGTACCCTCCGATA
AAGTCAAAACGGGGACACTAGTCAATCTCTTCTTCAAATACTGACTATTCTTCTCACAATCTTCACACCATATAAACTTAACTATCTTATGAGTCAATGT
GGTTAAAGGAGATGAATGGATGAAAAACCTTCTACAAATCTCCTATAGTAGCAAGCCAAGCCCAAGAAACTCCTAATATTAGTTGGAGATATGGGTCTAG
GCCAGTTTTGTACTGCATCAATTTTCTAGGTATCCATTCTAATACCAACACCGAAAAATATGTGACCCAAAAAATCCACAGACTCAAGACAAAACTCACA
TTTAGAGAACTTGGCGTACAACTCGTTGTCCTTTAACGTCTGTAGAACTACTCTGAGATGGCTAGCATGATATTTTTTCATTTATTGAATAGATTAGTAT
GTCATCAATGAAGATGATTACAAACATCTCTAAATAAGGTTTGAATACTTATATTCATAAGATTCATGAATTATTGTAATGGGCAATGGTCTATTTTCAC
TGCGTGCCTCATTTTAAAAAGTATTTCTTTTTTCTTAAAATCTGCCTCAAATGCTTCCTTGGGTAAATCATTTGTTTCCCCCTCTTTCCTAAATGTGAGA
ACCTCCTTTGTCCCTTTCTTGTGGATAGTTTATTTCTTTTCTTTTCTTGCTTTTCTTAATATT
>LE_HBa0169M14_SP6_14253 (trimmed for quality and cloning vector)
GACATAACCCAAACAAACTCTTTATGCATCACAATACACCACAAAACCTTGTGTACCCTCCGATAAAGTCAAAACGGGGACACTAGTCAATCTCTTCTTC
AAATACTGACTATTCTTCTCACAATCTTCACACCATATAAACTTAACTATCTTATGAGTCAATGTGGTTAAAGGAGATGAATGGATGAAAAACCTTCTAC
AAATCTCCTATAGTAGCAAGCCAAGCCCAAGAAACTCCTAATATTAGTTGGAGATATGGGTCTAGGCCAGTTTTGTACTGCATCAATTTTCTAGGTATCC
ATTCTAATACCAACACCGAAAAATATGTGACCCAAAAAATCCACAGACTCAAGACAAAACTCACATTTAGAGAACTTGGCGTACAACTCGTTGTCCTTTA
ACGTCTGTAGAACTACTCTGAGATGGCTAGCATGATATTTTTTCATTTATTGAAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.950077
Expected error %
0.25835
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38724.1| Score 141 E Value 5e-50 Identity 82.40% Align. Length 433bp (95.16%) Frame 2
putative retrotransposon protein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38744.1| Score 141 E Value 5e-50 Identity 82.40% Align. Length 433bp (95.16%) Frame 2
putative gag-pol polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0169M14
Clone
Clone name
hba-169m14
LE_HBa0169M14
P169M14
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found