Clone Read LE_HBa0169M14_T7_14254

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0169M14_T7_14254
Primer
T7
ID from Seq. Facility
LE_HBa_169_M14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
402 trimmed for vector and quality, 862 raw
Genbank Accession
Sequence
>LE_HBa0169M14_T7_14254 (raw untrimmed)
GCCCCGGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAAAGCAGATAGAAGTATTGATAGGTATAAGGCGAGGCTGGTAGCAAAAGGATACA
TGCAGGAATATGGAGTGGACTATCAGGAAACATTTGAACCAGTAGCTAAACTTAATATGATTCGTATCCTTATATCAGTTGCAGCAAACAGATATTGGTC
ATTGCGACAATTTGATGTAAAAAATGGATTCTTAAATGGCGACTTGGAGGAAGATGTTTACATGGATCTTCCACCAGGAATAATGCAGGCGCACACTTAT
AGAAACAAGGTATGCAGATTAAAGAAGGCATTATATGGGTTAAAACAGTCACCACGGGCATGGTTTGGACGTTTCCCATCCGAAAAGACATCGGTGGGTT
ATTAACAAAGTCACCTTTGATCACACTTCGTTTATCAAACACTACTAACGAATGGTAAATCCATTGATTGTGAATGTTGACCAAACTCGTTTTTAATCGG
TAATTTATTCCAATACCATTGGATCTCTTCCTACCCATCTCTATCTTATACTTCTTCATTTTTAATAACTTCTGAAATATTGTAACCTTTTATTACTTTC
TTTATTTATTAAGTTCCCCGACAAGTATCGCCACACTCTTGTTTCAAATATTTGAACTACTCATATCTTATTAATAGTCTCTCTTATTTTTCTAATTTGT
TGCCACTAATATTTTTATTCAAATTCTCATGACACACTCAACTTTATCCCTCTATTCATTTGTTTCCAATCAATCCTATAAACCATAGCCTCTCATACAA
AGTTATACGGCTATGCAATATATAAATCTCTGTCCTTACATCCACCCTCCCCTTTCCCACTC
>LE_HBa0169M14_T7_14254 (trimmed for quality and cloning vector)
AGCTTAAAGCAGATAGAAGTATTGATAGGTATAAGGCGAGGCTGGTAGCAAAAGGATACATGCAGGAATATGGAGTGGACTATCAGGAAACATTTGAACC
AGTAGCTAAACTTAATATGATTCGTATCCTTATATCAGTTGCAGCAAACAGATATTGGTCATTGCGACAATTTGATGTAAAAAATGGATTCTTAAATGGC
GACTTGGAGGAAGATGTTTACATGGATCTTCCACCAGGAATAATGCAGGCGCACACTTATAGAAACAAGGTATGCAGATTAAAGAAGGCATTATATGGGT
TAAAACAGTCACCACGGGCATGGTTTGGACGTTTCCCATCCGAAAAGACATCGGTGGGTTATTAACAAAGTCACCTTTGATCACACTTCGTTTATCAAAC
AC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.965876
Expected error %
0.922418
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 125 E Value 6e-30 Identity 16.40% Align. Length 365bp (90.80%) Frame 1
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP54332.1| Score 153 E Value 2e-36 Identity 20.70% Align. Length 356bp (88.56%) Frame 1
putative copia-like polyprotein [Oryza sativa (japonica cultivar-group)] ref|NP_922045.1| putative copia-like polyprotein [Oryza sativa (japonica cultivar-group)] gb|AAM91874.1| putative copia-like polyprotein [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAE75905.1| Score 152 E Value 3e-36 Identity 20.70% Align. Length 356bp (88.56%) Frame 1
OSJNBa0088I22.18 [Oryza sativa (japonica cultivar-group)] ref|XP_473549.1| OSJNBa0088I22.18 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0169M14
Clone
Clone name
hba-169m14
LE_HBa0169M14
P169M14
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found