Clone Read LE_HBa0169M15_T7_14256

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0169M15_T7_14256
Primer
T7
ID from Seq. Facility
LE_HBa_169_M15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
639 trimmed for vector and quality, 826 raw
Genbank Accession
Sequence
>LE_HBa0169M15_T7_14256 (raw untrimmed)
CCGGGACCCGCGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTACTCTTTTTTGTTTGCCTATAACACCGCTCTCGCAAAGACCCATATCAACAG
ACTTCAGACCCTCTAATGCTCCTTTTGCAACCAGCATCTTCATTCCTTTAGTACTCATGTGTCCAAGTCTGTTGTGCCACAAACATGAACCGGAAGCACC
TTCAGCAACAGCGGCCATGTTTATACACCCTGCAGTGGTGTACAACGTTCCAGATTTGGTGCCACGAGCCACTACCATAGCACCTTTCACGATCTTCCAC
GAACCTTTTCCAAACTCTGCTGCATATCCCGTGCTATCCAACTGACCAACAGAGATCAGATTTTTCTTGATCCCAGGAATATATATGACATCCTCCAATG
TCCACTGGTTTCCCGAGGTGGTCTTTATGCAAACATCCCCCTTTCATTCAATCTTTAAGGCTTTATTGTCAGCAAGATATACTTTTCCAAAATTTTCAAA
TTTGAAGTTTTGGAACAACTCCTTGCTTGGAGACGAATGGAAAGATGCACCAGAATCCAAAATCCATGATTCAACCGGGTTGTTCACACTAAGGATTAGA
GCATCCCCAATGTCTTCTGCTGAATTTACAAAATCATTGTCATCTCCAAATTTATGAATCTGTTTCTTCTTTGGCTTTGTACAGGTCGTAAGAAAGTGGC
CCTTGTTCCCCACATTTCCAACAAGTCACGTTTTGATTTGTTAAGTGAATTTCCCGCAATTCCTTTAATCTTTGATCAACCCAATGTAGAATTTAGGCCT
ATTCTGCCTATATTCCTCCCACCTCA
>LE_HBa0169M15_T7_14256 (trimmed for quality and cloning vector)
AGCTTACTCTTTTTTGTTTGCCTATAACACCGCTCTCGCAAAGACCCATATCAACAGACTTCAGACCCTCTAATGCTCCTTTTGCAACCAGCATCTTCAT
TCCTTTAGTACTCATGTGTCCAAGTCTGTTGTGCCACAAACATGAACCGGAAGCACCTTCAGCAACAGCGGCCATGTTTATACACCCTGCAGTGGTGTAC
AACGTTCCAGATTTGGTGCCACGAGCCACTACCATAGCACCTTTCACGATCTTCCACGAACCTTTTCCAAACTCTGCTGCATATCCCGTGCTATCCAACT
GACCAACAGAGATCAGATTTTTCTTGATCCCAGGAATATATATGACATCCTCCAATGTCCACTGGTTTCCCGAGGTGGTCTTTATGCAAACATCCCCCTT
TCATTCAATCTTTAAGGCTTTATTGTCAGCAAGATATACTTTTCCAAAATTTTCAAATTTGAAGTTTTGGAACAACTCCTTGCTTGGAGACGAATGGAAA
GATGCACCAGAATCCAAAATCCATGATTCAACCGGGTTGTTCACACTAAGGATTAGAGCATCCCCAATGTCTTCTGCTGAATTTACAAAATCATTGTCAT
CTCCAAATTTATGAATCTGTTTCTTCTTTGGCTTTGTAC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.971499
Expected error %
0.639558
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
pir||T02206 Score 161 E Value 1e-38 Identity 13.60% Align. Length 632bp (98.90%) Frame 3
hypothetical protein - common tobacco retrotransposon Tto1 dbj|BAA11674.1| ORF(AA 1-1338) [Nicotiana tabacum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV88069.1| Score 156 E Value 4e-37 Identity 13.40% Align. Length 632bp (98.90%) Frame 3
hypothetical retrotransposon [Ipomoea batatas]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0169M15
Clone
Clone name
hba-169m15
LE_HBa0169M15
P169M15
Clone type
BAC
Contamination
none
Estimated length
76,337
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found