Clone Read LE_HBa0044H11_SP6_142809

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0044H11_SP6_142809
Primer
SP6
ID from Seq. Facility
LE_HBa_044_H11-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
589 trimmed for vector and quality, 869 raw
Sequence
>LE_HBa0044H11_SP6_142809 (raw untrimmed)
ACCCCCTTTTTCAAACCAGATCATCGCCCTTTAGGCACGGCCATACATAACATATGAAATCACACTTAGGAAAGGGTGGACAATTAGCTAGAGCAGCGGG
TGCTGTAGCGAAACTGATTGCAAAAGAGGGGAAATCGGCCACATTAAAATTACCTTCTGGGGAGGTCCGTTTGATATCCAAAAACTGCTCAGCAACAGTC
GGACAAGTGGGGAATGTTGGGGTGAACCAGAAAAGTTTGGGTAGAGCCGGATCTAAGCGTTGGCTAGGTAAGCGTCCTGTAGTAAGAGGAGTAGTTATGA
ACCCTGTAGACCATCCCCATGGGGGTGGTGAAGGGAGAGCCCCAATTGGTAGAAAAAAACCCACAACCCCTTGGGGTTATCCTGCACTTGGAAGAAGAAG
TAGAAAAAGGAATAAATATAGTGATAATTTGATTCTTCGTCGCCGTAGTAAATAGGAGAGAAAATAGAATTTAATTATTCGTTTTTACAAAAACTTTACA
AAAAAAAAATAGGAGTAAGCTTGTGACACGTTCACTAAAAAAAAATCCCTTTGTAGCCAATCATTTATTAAAAAAAATTGATAAGCTTAACACAAAAGCA
GAAAAAGAAATAATAGTAACTTGGTCCCGGGCATCTACCATTATACCCACAATGATCGGTCATTCTATTGCTATCCATAAAGNCAAAGAGCATTTGCCCT
ATTTATATAACGGAATAAAATGGAGGCCAAAAATTGGGAAAATTTGCACCTCCATTAAATTTTAAAGGACATTGCAAAAAGCGATAATAGATTTCGGTGG
TTAATTTTAATAAAAAAATCTACATACTTTTTGATTTAGTATTTTGGGAACAAAACTCTTATGCCAAAA
>LE_HBa0044H11_SP6_142809 (trimmed for quality and cloning vector)
AAAGGGTGGACAATTAGCTAGAGCAGCGGGTGCTGTAGCGAAACTGATTGCAAAAGAGGGGAAATCGGCCACATTAAAATTACCTTCTGGGGAGGTCCGT
TTGATATCCAAAAACTGCTCAGCAACAGTCGGACAAGTGGGGAATGTTGGGGTGAACCAGAAAAGTTTGGGTAGAGCCGGATCTAAGCGTTGGCTAGGTA
AGCGTCCTGTAGTAAGAGGAGTAGTTATGAACCCTGTAGACCATCCCCATGGGGGTGGTGAAGGGAGAGCCCCAATTGGTAGAAAAAAACCCACAACCCC
TTGGGGTTATCCTGCACTTGGAAGAAGAAGTAGAAAAAGGAATAAATATAGTGATAATTTGATTCTTCGTCGCCGTAGTAAATAGGAGAGAAAATAGAAT
TTAATTATTCGTTTTTACAAAAACTTTACAAAAAAAAAATAGGAGTAAGCTTGTGACACGTTCACTAAAAAAAAATCCCTTTGTAGCCAATCATTTATTA
AAAAAAATTGATAAGCTTAACACAAAAGCAGAAAAAGAAATAATAGTAACTTGGTCCCGGGCATCTACCATTATACCCACAATGATCGG

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.954958
Expected error %
0.1778
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g44065.2 Score 97 E Value 6e-21 Identity 15.60% Align. Length 320bp (54.33%) Frame 3
68415.m05480 ribosomal protein L2 family protein similar to ribosomal protein L2 [Gossypium arboreum] GI:17644114; contains Pfam profile PF03947: Ribosomal Proteins L2, C-terminal domain
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g44065.1 Score 97 E Value 6e-21 Identity 15.60% Align. Length 320bp (54.33%) Frame 3
68415.m05479 ribosomal protein L2 family protein similar to ribosomal protein L2 [Gossypium arboreum] GI:17644114; contains Pfam profile PF03947: Ribosomal Proteins L2, C-terminal domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA77409.1| Score 232 E Value 4e-60 Identity 30.40% Align. Length 380bp (64.52%) Frame 3
ribosomal protein L2 [Nicotiana tabacum] emb|CAA77384.1| ribosomal protein L2 [Nicotiana tabacum] ref|NP_054577.1| ribosomal protein L2 [Nicotiana tabacum] ref|NP_054540.1| ribosomal protein L2 [Nicotiana tabacum] pir||R5NT2 ribosomal protein L2 - common tobacco chloroplast sp|P06379|RK2_TOBAC Chloroplast 50S ribosomal protein L2 prf||1211235BW ribosomal protein L2
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAC88085.1| Score 232 E Value 4e-60 Identity 30.40% Align. Length 380bp (64.52%) Frame 3
ribosomal protein L2 [Atropa belladonna] ref|NP_783272.1| ribosomal protein L2 [Atropa belladonna] sp|Q8S8V3|RK2A_ATRBE Chloroplast 50S ribosomal protein L2-1
Nicotiana tabacum Chloroplast (screening/organelle/nicotiana_tabacum_chloroplast)NCBI BLAST
gi|11465934|ref|NC_001879.1| Score 773 E Value 0 Identity 95.30% Align. Length 588bp (99.83%) Frame 2
Nicotiana tabacum plastid, complete genome
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0044H11
Clone
Clone name
hba-44h11
LE_HBa0044H11
C03HBa0044H11
P044H11
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found