Clone Read LE_HBa0044H11_T7_142810

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0044H11_T7_142810
Primer
T7
ID from Seq. Facility
LE_HBa_044_H11-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
729 trimmed for vector and quality, 911 raw
Sequence
>LE_HBa0044H11_T7_142810 (raw untrimmed)
TGGGGGTCCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCCTTCGTAACTCCCGGAACTTCTTCGTAGTGGCTCCCTTACATGCCTCATTT
CAGAGGGAACCTCAAAGTGGCTCTATTTCATTATATTCCATCCATATCCCAATTCCATTCATTTAATATCCCTTTGGTGTCATTGACATAACAGATGTCG
TTTCTAGTCTATCTCTTTCTATTTCTTTTCTATATATGGAAAGTTCAAAAATCATCATATAATAATCCAGAAATTGCAATAGAAAAGAAATAAGGGAGGT
TTGTGATGATTTTTCAATCTTTTCTACTAGGTAATCTAGTATCCTTATGCATGAAGATAATCAATTCGGTCGTTGTGGTCGGACTCTATTATGGATTTCT
GACCACATTCTCCATAGGGCCCTCCTATCTCTTCCTTCTCCGAGCTCTGGTTATGGAAGAAGGAACCGAGAAGAAGGTATCAGCAACAACTGGTTTTATT
ACGGGACAGCTCATGATGTTCATATCGATCTATTATGCGCCTCTGCATCTAGCATTGGGTAGACCTCATACAATAACTGTCCTAGCTCTACCATATCTTT
TGTTTCATTTCTTCTGGAACAATCACAAACACTTTTTTGATTATGGATCTACTACCAGAAATTCAATGCGTAATCTCAGCATTCAATGTGTATTCCTGAA
TAATCTCATTTTTCAATTATTCAACCATTTCATTTTACCAAGTTCAATGTTAGCCAGATTTAGTCAACATTTATCTCTTTCCAATGCACAACAACATCTT
ATTTTTTACAAAGTGGTTTTGTTGGTTGGGGTAAATGGGGACCTATTATTTCATGAAAATGGCTTTGGATTTGGTATAAACCCGGGAACCCGCAACAAAC
ACTTCCAATGA
>LE_HBa0044H11_T7_142810 (trimmed for quality and cloning vector)
AGCTTCCTTCGTAACTCCCGGAACTTCTTCGTAGTGGCTCCCTTACATGCCTCATTTCAGAGGGAACCTCAAAGTGGCTCTATTTCATTATATTCCATCC
ATATCCCAATTCCATTCATTTAATATCCCTTTGGTGTCATTGACATAACAGATGTCGTTTCTAGTCTATCTCTTTCTATTTCTTTTCTATATATGGAAAG
TTCAAAAATCATCATATAATAATCCAGAAATTGCAATAGAAAAGAAATAAGGGAGGTTTGTGATGATTTTTCAATCTTTTCTACTAGGTAATCTAGTATC
CTTATGCATGAAGATAATCAATTCGGTCGTTGTGGTCGGACTCTATTATGGATTTCTGACCACATTCTCCATAGGGCCCTCCTATCTCTTCCTTCTCCGA
GCTCTGGTTATGGAAGAAGGAACCGAGAAGAAGGTATCAGCAACAACTGGTTTTATTACGGGACAGCTCATGATGTTCATATCGATCTATTATGCGCCTC
TGCATCTAGCATTGGGTAGACCTCATACAATAACTGTCCTAGCTCTACCATATCTTTTGTTTCATTTCTTCTGGAACAATCACAAACACTTTTTTGATTA
TGGATCTACTACCAGAAATTCAATGCGTAATCTCAGCATTCAATGTGTATTCCTGAATAATCTCATTTTTCAATTATTCAACCATTTCATTTTACCAAGT
TCAATGTTAGCCAGATTTAGTCAACATTT

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.950399
Expected error %
0.2725
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g07739.1 Score 240 E Value 7e-64 Identity 28.30% Align. Length 452bp (62.00%) Frame 3
68415.m00990 expressed protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
prf||1211235CL Score 271 E Value 1e-71 Identity 30.70% Align. Length 455bp (62.41%) Frame 3
ORF 350
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA77394.1| Score 270 E Value 3e-71 Identity 30.50% Align. Length 455bp (62.41%) Frame 3
hypothetical protein [Nicotiana tabacum] ref|NP_054553.1| hypothetical protein NitaCp079 [Nicotiana tabacum] pir||A05212 hypothetical protein 350 - common tobacco chloroplast
Arabidopsis thaliana Mitochondria (screening/organelle/ATH1_mitochondria)NCBI BLAST
mitochondria Score 1007 E Value 0 Identity 94.40% Align. Length 713bp (97.81%) Frame 2
No sequence description found.
Nicotiana tabacum Chloroplast (screening/organelle/nicotiana_tabacum_chloroplast)NCBI BLAST
gi|11465934|ref|NC_001879.1| Score 1413 E Value 0 Identity 99.60% Align. Length 728bp (99.86%) Frame 2
Nicotiana tabacum plastid, complete genome
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0044H11
Clone
Clone name
hba-44h11
LE_HBa0044H11
C03HBa0044H11
P044H11
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found