Clone Read LE_HBa0169P10_SP6_14389

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0169P10_SP6_14389
Primer
SP6
ID from Seq. Facility
LE_HBa_169_P10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
583 trimmed for vector and quality, 798 raw
Genbank Accession
Sequence
>LE_HBa0169P10_SP6_14389 (raw untrimmed)
GATTTTAAAAAATTTCAGATATGCTAATTTTATGAATGATATGGTGACATAGAAGAGGTTGGTTCATTTTGAAGATTATGACAGAATGCAGAATTATACT
TCTATTGCCACAAGGTCAGGATCTAGGCGCCTTCACTATTCTATGTACTATAGGGCTGCTACACCCAAGGATTTGTATGATCTTGGTGCGAGCATAAATC
TCATGCCACCGTTAATTTATGAGAAGTTAGGCTTTGGGGATCTAAAGTCTACCACGATGATGTTACTAATGGCTGATCGAACTTTGAAGAGGCCCATAGA
TGTATTCCATGATGTGCTTTAGAAAGTTGAGTTGTACATCTTTATGACGGATTTTGTGACTCTTGACTGTGAGGTTCCCCCCCAGGTCCCATTATTCCTG
GGAGACCATTCTTTCCACTGGGCATTGATATACCGTGGTTTCACGGTATAATTAATACTTTTCCCCTAAGTTTAGTGTGTCCGAAAGCCCTTTTTGTGCT
AATTTTGATATAAGTTTTTCTTTGTTTTGCAGGAAATCTGTCTAAAGCTGAATGCGGATATTTTTAGCGAAAAATTTAGAAGAGACCACCTACGGAGCTT
ATGACTGTCCATCTTGCTTGTGACGGTCCGTAGGTGGCAGCGTAAAGAACCTGCTGAAGGAAAATGGGGAAGTCTGACCAACTGTTGGATTAACCAATCT
TGAGATTGTTCTTCATGGATAATTACCGTCCCTTTCTCGCTAGGTTCATTTACATATAACTACAATAAGTATTTTCCTTTACACCATTGCCTACAATT
>LE_HBa0169P10_SP6_14389 (trimmed for quality and cloning vector)
TATGCTAATTTTATGAATGATATGGTGACATAGAAGAGGTTGGTTCATTTTGAAGATTATGACAGAATGCAGAATTATACTTCTATTGCCACAAGGTCAG
GATCTAGGCGCCTTCACTATTCTATGTACTATAGGGCTGCTACACCCAAGGATTTGTATGATCTTGGTGCGAGCATAAATCTCATGCCACCGTTAATTTA
TGAGAAGTTAGGCTTTGGGGATCTAAAGTCTACCACGATGATGTTACTAATGGCTGATCGAACTTTGAAGAGGCCCATAGATGTATTCCATGATGTGCTT
TAGAAAGTTGAGTTGTACATCTTTATGACGGATTTTGTGACTCTTGACTGTGAGGTTCCCCCCCAGGTCCCATTATTCCTGGGAGACCATTCTTTCCACT
GGGCATTGATATACCGTGGTTTCACGGTATAATTAATACTTTTCCCCTAAGTTTAGTGTGTCCGAAAGCCCTTTTTGTGCTAATTTTGATATAAGTTTTT
CTTTGTTTTGCAGGAAATCTGTCTAAAGCTGAATGCGGATATTTTTAGCGAAAAATTTAGAAGAGACCACCTACGGAGCTTAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.965707
Expected error %
0.525391
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
pir||T12084 Score 71 E Value 2e-11 Identity 14.30% Align. Length 236bp (40.48%) Frame 2
hypothetical protein - fava bean (fragment) dbj|BAA22786.1| retrotransposon-like gene~the first amino acid was determined to be glycine [Vicia faba]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0169P10
Clone
Clone name
hba-169p10
LE_HBa0169P10
P169P10
Clone type
BAC
Contamination
none
Estimated length
118,121
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found