Clone Read LE_HBa0170M09_T7_14801

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0170M09_T7_14801
Primer
T7
ID from Seq. Facility
LE_HBa_170_M09-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
161 trimmed for vector and quality, 925 raw
Sequence
>LE_HBa0170M09_T7_14801 (raw untrimmed)
CCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTTAAATTCCAAATGTTTTGACCTTATTAGTTTTTATAAAATTCAAAAAAA
AAGTTACTTTTAATTAATTTGGGAAAATGCACAAGTACCCCCTCAACCTATGCCCGAAATCGCAGAGACACACTTATACTATACTAAGGTCCTATTATCC
CCCCCCCCCGTAAACTTATTTTATTAGTTATCTCTCTATATCTTTTGTAACTTACGTGTGTGTTGGATTGAATTATAAGTTTTATAATCTTTAGCTCCCT
CAGACTGTCGCTCCCACACGTAGCTTAGGGGGTTCATGCCATGTGTATCCATTGTTTGATGGGGGCAATATAGTCGCCCGCTTATGGTTATTGTTTGACT
CTCTTGTTCTTTGTCTCTTTTTTCTATTTTTCCCTCCTTAAACTAATTCCTCTGTTGGTTTGTAATCCATCCCGCACCCACTGTCCGTCTTCTTTCTTTC
TCCTCCCGCTAGTTTGTTGTTTTTCTTTCTCTCTTGGTTCTTGTATTTCTTTTTTTTACGTTAGACATTGTTTATTAGTTTATTATTTTTTGAATTTCAT
GTGTTTTTTAGTTCTTCTGTTTTTTTCAAGCTTAGTATTGTCGTGGTTTGTGTATGTTGTGTTGCCTTGTCGTTTTTGACGTCACAAAGATGTGTGGCTA
TATATCTGTCTAGGTTGGTAGCGATTTTTCTATGTATTGTTACTTTATGATCATTGTGGCTATGCCTATCATAGTTTTTGTCTGGTAATGTCGTTTCCGC
TCCTATATATATTCTTACTGCTTGTGTGTAACCATCTCATGTCTATCGTTGTGTTCTCATATTATTATTATTCTGCTATTTTCTCCTGCATAAGTACGAT
ACGTGTTGGACGTATAGTTGACTTC
>LE_HBa0170M09_T7_14801 (trimmed for quality and cloning vector)
AGCTTCTTAAATTCCAAATGTTTTGACCTTATTAGTTTTTATAAAATTCAAAAAAAAAGTTACTTTTAATTAATTTGGGAAAATGCACAAGTACCCCCTC
AACCTATGCCCGAAATCGCAGAGACACACTTATACTATACTAAGGTCCTATTATCCCCCCC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.915025
Expected error %
0.418442
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0170M09
Clone
Clone name
hba-170m9
LE_HBa0170M09
P170M09
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found