Clone Read LE_HBa0070B10_T7_15043

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0070B10_T7_15043
Primer
T7
ID from Seq. Facility
LE_HBa_070_B10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
694 trimmed for vector and quality, 743 raw
Genbank Accession
Sequence
>LE_HBa0070B10_T7_15043 (raw untrimmed)
TCTCGGTACCCGCGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGGAGATTGCTTGTTGATTCCAATTCTTCGGTGGAGGTAGGTTATGGTTT
CCCTTACGATATTCGTAGTAAACTCTTAATAGAGAATGATATGTATTGATAATATTGTAAACCCTGCTATATGCTTAATTGTATGCTTGCATGAATATGA
TTATGTGATTGTGATAAGATAAGCATGATGAAAATATTGAATCCCAAATCTTGAAAAGAAACTTTAATATACATTATTGATGATGATGCCTTGGTATAGA
AGAAGGCTTGATGAATTAAAGTAATGGGATTGAGGATGCCTTGGTATAGAGAAGGCTTGATGATTTACAGAATGATATTAGGGGATCGGGTGTCACGAAC
CGACACGTAGATTTAGTGGATCGGAGTGTCACGTACCGACACATGTAGGGGATCGGGTGTCACGAACCGACACGTAGAATTAGGGGATCGGGTGTCACGA
ACCGACACGTAGAATTAGGGGATCGGGTGTCACAAACCGACACGTAGAATTAGGGGATCGGGTGTCACGAACCGACACGTAGATTTAGGGGATCGGGTGT
CACGAACCGACACGTAAATTTAGGGGATCGGAGTGTCACGTACTGACACCAGAGAAATAAAGATAATGAATTCCTGAAAGATGTTAAATATACTCAATCT
AATGAACATTGATTCCCAAATGAGTATGGTAATTGGGGGCTGA
>LE_HBa0070B10_T7_15043 (trimmed for quality and cloning vector)
AGCTTGGGAGATTGCTTGTTGATTCCAATTCTTCGGTGGAGGTAGGTTATGGTTTCCCTTACGATATTCGTAGTAAACTCTTAATAGAGAATGATATGTA
TTGATAATATTGTAAACCCTGCTATATGCTTAATTGTATGCTTGCATGAATATGATTATGTGATTGTGATAAGATAAGCATGATGAAAATATTGAATCCC
AAATCTTGAAAAGAAACTTTAATATACATTATTGATGATGATGCCTTGGTATAGAAGAAGGCTTGATGAATTAAAGTAATGGGATTGAGGATGCCTTGGT
ATAGAGAAGGCTTGATGATTTACAGAATGATATTAGGGGATCGGGTGTCACGAACCGACACGTAGATTTAGTGGATCGGAGTGTCACGTACCGACACATG
TAGGGGATCGGGTGTCACGAACCGACACGTAGAATTAGGGGATCGGGTGTCACGAACCGACACGTAGAATTAGGGGATCGGGTGTCACAAACCGACACGT
AGAATTAGGGGATCGGGTGTCACGAACCGACACGTAGATTTAGGGGATCGGGTGTCACGAACCGACACGTAAATTTAGGGGATCGGAGTGTCACGTACTG
ACACCAGAGAAATAAAGATAATGAATTCCTGAAAGATGTTAAATATACTCAATCTAATGAACATTGATTCCCAAATGAGTATGGTAATTGGGGG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.955914
Expected error %
0.225202
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0070B10
Clone
Clone name
hba-70b10
LE_HBa0070B10
P070B10
Clone type
BAC
Contamination
none
Estimated length
93,296
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found