Clone Read LE_HBa0004P13_SP6_1512

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0004P13_SP6_1512
Primer
SP6
ID from Seq. Facility
LE_Hba_004_P13-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
731 trimmed for vector and quality, 1169 raw
Genbank Accession
Sequence
>LE_HBa0004P13_SP6_1512 (raw untrimmed)
GGGGGGGCGCTAGTGAAATTACCGTTACATCCCCTACGAATTCACATTTCCCTTTCCATTTCTCCGGTGGAGGTGGCACGTTTTTATCACTAAAACATGG
ATGACCTGGATTAATCCCAGTATCCAGAACCCCAATAATCACACCTTTACCATAATTCGACTCTTGCCAGAGCCCCACATTCTGATACAACCCCAAAAAG
TTTGGAGTACGCGTTATATGCAAAGCTAAAATCTTCTCAACCCTCGCGTACACAAAACCATCTTTCATTTCCATTTCTTTTACCTCCTCAGCTGACAATC
TGGCTGCAAAACCTGATACCACATGGTGATATGAGTGAATAATTCGCGTTGGCTCCTCTGAACCAACAATCTCTACCGGTACAAAAGAGTTATAATAACT
TTCCAAATCAGCTGAATTAGCGACAACTTGTACATCAGGCTTATTTACATGAACAATATAAGTTTGCAAACTGCTCTGAGGTTGAGCAACTACGAAATGA
AAAATCAACCAAAAAGCAAACGAGATGATCAAAATGCAAGTCATGGTTAGTCTTTCTATCATCATATACAACCCCTAGTGAAGAAACAGGTTCTTTAAAC
TACGAGTTAACGGAAGAATAATACGATAAACCAAGCAAAGAAAACGAAAAAGAGAGCTTTCTAATACAACCGGCTTACAAACAAAGTCACTGTTATTTTA
TTTTAGAATAAAGAAAAACATAACAAGAAGACACCAAGTAAACCAGAATGCTGGATTGTTTAAAGAGACGAAAACTGTATTATTTATTTCATTGGGCGAT
TAAATTAATAATTCACCCTTCTAACTAAATCAGCATTGACAATGTAGTCAGAGTTTTGGGTTAGCAAAAAATTGTGGGAACACAAACTTGATACGTTATC
CCTTGTATATATTTTCAAGTAAACTAGTTGAAAATTATTTCTTTCTATACTTTGGACTATTATATGGCGATTGACCAAACCCCCTTAAAATCGTTGGGTT
TTTTGGTAAATTTTTCCATTTGGTCTTCCTGGGGCTTTTGGAGGGTTTGTTTTGCCACCCTTCCCATTAAAAAAAAATTATTTTTGGGTCCTAAAGTTTA
ACCCCCAATATTTGGGAAGCTTTTCGCTGAAAACCCACCCAAAAAATTTAAATTTCCAAATTTCAAAAA
>LE_HBa0004P13_SP6_1512 (trimmed for quality and cloning vector)
ATCCCCTACGAATTCACATTTCCCTTTCCATTTCTCCGGTGGAGGTGGCACGTTTTTATCACTAAAACATGGATGACCTGGATTAATCCCAGTATCCAGA
ACCCCAATAATCACACCTTTACCATAATTCGACTCTTGCCAGAGCCCCACATTCTGATACAACCCCAAAAAGTTTGGAGTACGCGTTATATGCAAAGCTA
AAATCTTCTCAACCCTCGCGTACACAAAACCATCTTTCATTTCCATTTCTTTTACCTCCTCAGCTGACAATCTGGCTGCAAAACCTGATACCACATGGTG
ATATGAGTGAATAATTCGCGTTGGCTCCTCTGAACCAACAATCTCTACCGGTACAAAAGAGTTATAATAACTTTCCAAATCAGCTGAATTAGCGACAACT
TGTACATCAGGCTTATTTACATGAACAATATAAGTTTGCAAACTGCTCTGAGGTTGAGCAACTACGAAATGAAAAATCAACCAAAAAGCAAACGAGATGA
TCAAAATGCAAGTCATGGTTAGTCTTTCTATCATCATATACAACCCCTAGTGAAGAAACAGGTTCTTTAAACTACGAGTTAACGGAAGAATAATACGATA
AACCAAGCAAAGAAAACGAAAAAGAGAGCTTTCTAATACAACCGGCTTACAAACAAAGTCACTGTTATTTTATTTTAGAATAAAGAAAAACATAACAAGA
AGACACCAAGTAAACCAGAATGCTGGATTGT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.959607
Expected error %
0.197425
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g14067.1 Score 115 E Value 3e-26 Identity 13.30% Align. Length 497bp (67.99%) Frame 2
68416.m01775 subtilase family protein contains similarity to cucumisin-like serine protease GI:3176874 from [Arabidopsis thaliana]
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g67090.1 Score 104 E Value 4e-23 Identity 12.00% Align. Length 506bp (69.22%) Frame 2
68418.m08459 subtilase family protein contains similarity to subtilisin-like protease ag12 GI:757522 from [Alnus glutinosa]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA76725.1| Score 187 E Value 2e-46 Identity 21.00% Align. Length 437bp (59.78%) Frame 2
P69B protein [Lycopersicon esculentum] emb|CAA71234.1| subtilisin-like protease [Lycopersicon esculentum] pir||T07184 subtilisin-like proteinase (EC 3.4.21.-) precursor P69B, pathogenesis-related - tomato
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA76727.1| Score 184 E Value 2e-45 Identity 20.80% Align. Length 437bp (59.78%) Frame 2
P69D protein [Lycopersicon esculentum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0004P13
Clone
Clone name
hba-4p13
LE_HBa0004P13
C08HBa0004P13
P004P13
Clone type
BAC
Contamination
none
Estimated length
80,138
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found