Clone Read LE_HBa0070F01_SP6_15216

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0070F01_SP6_15216
Primer
SP6
ID from Seq. Facility
LE_HBa_070_F01-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
376 trimmed for vector and quality, 655 raw
Genbank Accession
Sequence
>LE_HBa0070F01_SP6_15216 (raw untrimmed)
GCTGGTCCTTTTTTTTCATGACAGAAAACCTAGATCTGGAGCTAGGAGAGCTATCGTGGCGTATAATTTCATCGATCGAGCAGAAAGAGGAGAGTCGTGG
TAACGAAGATCACGTTGCCTCCATTAAGAAATACAGATCTCAGATCGAGAATGAGCTGACTTCGATCTGTAACGGCATCCTCAAGTTGCTTGATTCCAAA
CTCATCGGGTCAGCTGCTACCGGAGACTCCAAGGTTTTCTATTTGAAAATGAAGGGAGATTACTACCGGTACTTGGCTGAGTTCAAAACCGGAACCGAGA
GAAAAGAAGCTGCAGAGAATACTCTTTCGGCCTACAAGTCTGCTCAGGTATTTAGACTTTCATTCTTTATAAAATGTGGAGGAAAATCTCATATGAGTCC
TGCGAACGGGAATGTTCTATGTGTGTTAAATTAGGAAATTGCATAAACAAGTACTGCAAGTCACCTTTTTTATTATGAAGAGTAACCAATATCCATTAGA
TTTCGTCTTCCAAGGGAAAAAATGTTTCCCGTGGTGAAACCATGTAGCTTAATTATCATCAAGCATTAACCTCACTTCTTCCTCTTTTCCGGCTCTTCGC
TAATGGTGCTTTTCTCTCCAACACCTCCCATCCGAGTTGGGGCCTAGGCCCCTGT
>LE_HBa0070F01_SP6_15216 (trimmed for quality and cloning vector)
AGCTAGGAGAGCTATCGTGGCGTATAATTTCATCGATCGAGCAGAAAGAGGAGAGTCGTGGTAACGAAGATCACGTTGCCTCCATTAAGAAATACAGATC
TCAGATCGAGAATGAGCTGACTTCGATCTGTAACGGCATCCTCAAGTTGCTTGATTCCAAACTCATCGGGTCAGCTGCTACCGGAGACTCCAAGGTTTTC
TATTTGAAAATGAAGGGAGATTACTACCGGTACTTGGCTGAGTTCAAAACCGGAACCGAGAGAAAAGAAGCTGCAGAGAATACTCTTTCGGCCTACAAGT
CTGCTCAGGTATTTAGACTTTCATTCTTTATAAAATGTGGAGGAAAATCTCATATGAGTCCTGCGAACGGGAATGT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.970445
Expected error %
0.30024
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g78300.1 Score 163 E Value 2e-41 Identity 26.90% Align. Length 293bp (77.93%) Frame 1
68414.m09125 14-3-3 protein GF14 omega (GRF2) identical to GF14omega isoform GI:487791 from [Arabidopsis thaliana]
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g35160.1 Score 159 E Value 5e-40 Identity 25.50% Align. Length 293bp (77.93%) Frame 1
68414.m04360 14-3-3 protein GF14 phi (GRF4) identical to GF14 protein phi chain GI:1493805, SP:P46077 from [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA65148.1| Score 194 E Value 6e-49 Identity 33.30% Align. Length 293bp (77.93%) Frame 1
14-3-3 protein [Lycopersicon esculentum] sp|P93210|1435_LYCES 14-3-3 protein 5
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAS78777.1| Score 194 E Value 6e-49 Identity 33.30% Align. Length 293bp (77.93%) Frame 1
14-3-3 protein [Solanum chacoense]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0070F01
Clone
Clone name
hba-70f1
LE_HBa0070F01
C04HBa0070F01
P070F01
Clone type
BAC
Contamination
none
Estimated length
95,865
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found