Clone Read LE_HBa0070F01_T7_15217

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0070F01_T7_15217
Primer
T7
ID from Seq. Facility
LE_HBa_070_F01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
643 trimmed for vector and quality, 715 raw
Genbank Accession
Sequence
>LE_HBa0070F01_T7_15217 (raw untrimmed)
CTCGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTACATTGCATTTCAAAGAAAACAGCTATTGTGAACGCAAAAGACTATGATAA
GATGGATGACAATGAGTTAGCTGACCTGGTGCAAAAGAACCTAAAGGGTCCAAGATACCTTGTTGTTGTTGATGATATTTGGACTGAAAATGTTTGGGAT
AGTGTAAGAGGAATATTTCCTAATTACAACAATGGGAGTCGAATCTTATTGACTACTAGGGAAAATGAGGTAGCAATGTATGCAAATACTTGTAGCCCTC
ATGAGATGAGCCTTTTGAGTGGAGAAAATGGTTGGAAGTTAGTTTGTGATAAGGTGTTTGGACCAAAACATGATCATCCTCCCGAATTGGAAGAAATTGG
AAAGGAAATAGTAGAAAAATGCCAAGGACTACCCTTAACAATTTCAGTGATTGCAGGACATCTCTGTAAAGTGGCCAGGACATTAGAAGGTTGGAAGGAT
GTTGCCCGAACCTTAAGTGAAATCATTGCTAGTCATCCAGATGAATGCTTAGCAGTGCTCGGTTTGAGTTATCACCACTTGCCTAATCACCTCAAACCTT
GCTTTCTATCTATGAGTAGTTTCCCAGAGGATTTTCAGGTTGAGACTCGGATATTGATTCCATTATGGATTGCACAACGTTTCATAAGGACTTTCGAAAA
TGGTAAAAATTTGCN
>LE_HBa0070F01_T7_15217 (trimmed for quality and cloning vector)
AGCTTTACATTGCATTTCAAAGAAAACAGCTATTGTGAACGCAAAAGACTATGATAAGATGGATGACAATGAGTTAGCTGACCTGGTGCAAAAGAACCTA
AAGGGTCCAAGATACCTTGTTGTTGTTGATGATATTTGGACTGAAAATGTTTGGGATAGTGTAAGAGGAATATTTCCTAATTACAACAATGGGAGTCGAA
TCTTATTGACTACTAGGGAAAATGAGGTAGCAATGTATGCAAATACTTGTAGCCCTCATGAGATGAGCCTTTTGAGTGGAGAAAATGGTTGGAAGTTAGT
TTGTGATAAGGTGTTTGGACCAAAACATGATCATCCTCCCGAATTGGAAGAAATTGGAAAGGAAATAGTAGAAAAATGCCAAGGACTACCCTTAACAATT
TCAGTGATTGCAGGACATCTCTGTAAAGTGGCCAGGACATTAGAAGGTTGGAAGGATGTTGCCCGAACCTTAAGTGAAATCATTGCTAGTCATCCAGATG
AATGCTTAGCAGTGCTCGGTTTGAGTTATCACCACTTGCCTAATCACCTCAAACCTTGCTTTCTATCTATGAGTAGTTTCCCAGAGGATTTTCAGGTTGA
GACTCGGATATTGATTCCATTATGGATTGCACAACGTTTCATA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.966701
Expected error %
0.846228
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g50950.2 Score 130 E Value 5e-31 Identity 12.90% Align. Length 581bp (90.36%) Frame 3
68416.m05579 disease resistance protein (CC-NBS-LRR class), putative domain signature CC-NBS-LRR exists, suggestive of a disease resistance protein.
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g50950.1 Score 130 E Value 5e-31 Identity 12.90% Align. Length 581bp (90.36%) Frame 3
68416.m05578 disease resistance protein (CC-NBS-LRR class), putative domain signature CC-NBS-LRR exists, suggestive of a disease resistance protein.
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB50786.1| Score 198 E Value 1e-49 Identity 16.40% Align. Length 578bp (89.89%) Frame 3
Rx protein [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB56299.1| Score 197 E Value 2e-49 Identity 16.40% Align. Length 578bp (89.89%) Frame 3
NBS-LRR protein [Solanum acaule]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0070F01
Clone
Clone name
hba-70f1
LE_HBa0070F01
C04HBa0070F01
P070F01
Clone type
BAC
Contamination
none
Estimated length
95,865
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found