Clone Read LE_HBa0070K23_T7_15501

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0070K23_T7_15501
Primer
T7
ID from Seq. Facility
LE_HBa_070_K23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
614 trimmed for vector and quality, 709 raw
Genbank Accession
Sequence
>LE_HBa0070K23_T7_15501 (raw untrimmed)
CTCGGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAATGATGCTAGTAATAGTATGGCGACCCGTGACCCCGCACCCCCACCCCA
CGCCCACCCCACCCAACCCCCAACCAAGAAAAGTGGCAGCTTTAATAATGATTTCGCTTGTAATTGGCTAAATTGTTTTAATTTTGATCGAATTTATTGT
TGCGATACTAAACTTTTATGAGGTTCTATTATTTTCCTAAACTATTTAATAGTATATTTTTAAGATATATATATGCCTATGTTGACACATTATTATAATT
TTACGTTATTTTTTATGTTCACGTAGACAAATATATAGGTTTAAAATACGATATTAAATAATCTAGATTCTAGGAAGTAGGGAGGTAATAGATTCTTATG
AAAGTTTACTATCGTAACATCAAATTCGACCAAAATTAAGAAATTTTTTAGACTTTTATCTTAATATTTTATATAATTAATTTATTTATGTAATGAAAGC
TTATGAATGTACGAGTCAAAAAAAGTGTCTAAATTGAAACATGTTATTGAAGTTGTCCAAGTATTCAATCAACAGAAAAAAAAAACATTACCAATTAAGA
TCTTGACCACTTGATGAAGATCAATATCTAGACATGATCTGTTAAAAGTAGATTTTAAAATCCTAAATCCTAATAGCACCATAATGGAAAACATATGACA
TTTCTGAAC
>LE_HBa0070K23_T7_15501 (trimmed for quality and cloning vector)
AGCTTGAATGATGCTAGTAATAGTATGGCGACCCGTGACCCCGCACCCCCACCCCACGCCCACCCCACCCAACCCCCAACCAAGAAAAGTGGCAGCTTTA
ATAATGATTTCGCTTGTAATTGGCTAAATTGTTTTAATTTTGATCGAATTTATTGTTGCGATACTAAACTTTTATGAGGTTCTATTATTTTCCTAAACTA
TTTAATAGTATATTTTTAAGATATATATATGCCTATGTTGACACATTATTATAATTTTACGTTATTTTTTATGTTCACGTAGACAAATATATAGGTTTAA
AATACGATATTAAATAATCTAGATTCTAGGAAGTAGGGAGGTAATAGATTCTTATGAAAGTTTACTATCGTAACATCAAATTCGACCAAAATTAAGAAAT
TTTTTAGACTTTTATCTTAATATTTTATATAATTAATTTATTTATGTAATGAAAGCTTATGAATGTACGAGTCAAAAAAAGTGTCTAAATTGAAACATGT
TATTGAAGTTGTCCAAGTATTCAATCAACAGAAAAAAAAAACATTACCAATTAAGATCTTGACCACTTGATGAAGATCAATATCTAGACATGATCTGTTA
AAAGTAGATTTTAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.923679
Expected error %
0.396009
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0070K23
Clone
Clone name
hba-70k23
LE_HBa0070K23
P070K23
Clone type
BAC
Contamination
none
Estimated length
60,259
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found