Clone Read LE_HBa0070N08_T7_15615

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0070N08_T7_15615
Primer
T7
ID from Seq. Facility
LE_HBa_070_N08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
706 trimmed for vector and quality, 749 raw
Genbank Accession
Sequence
>LE_HBa0070N08_T7_15615 (raw untrimmed)
CCGGGACCCGGGGGTACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGATCAATCATACAATATTATCTCGTGATTTTTGTAAAGTCTCACCTAGCTA
ATAAAAAATATATTATTAAAAAACTTTGATGTAATAAATGAAAGAAGAGTATTTTTTAACTTCGAACCTGTCGAAGATGATGGGAGTGTATATTCATTGC
AATTCAAAAATTATAACAATCATAATGCATTTAATTTAAGAAATGAAAAGATATTAATGACTCAACTTAAACATATTTGATACAATTTCATAATTTTGAG
AAAAGAGTACAAACAACTTGCCATGATACAACAATTAAACACATCAAAAAGCAATACAAAAAAAAAAGTCAAGAAACTCACAAACGTATCATAATGAATC
GTAAACACAAAAACAAAGATGACCATAAACATTTAAACTTTAAACTCTCTCCTTAATAACAAGGAAAGAAATAACCAAACTGAAAAATCCAACCACCATT
GAAGGCAATGAGGTGATTATGGCACCGGAGGATTGCGATGGAGAGGGGGCGGGGGCGGGGGCATGGTGGTCATGGCCCTCATGAGCTATAACAACAGACG
CTAAAAATACAACACAAGCAATGAAGTTGAATGCAACACTTGAAACTTTGAAAGCCATTACTTTCTCGTTTTTCAAAATTCAAATATTGCCTTCAACTTG
TTTTATTCTCAACTTGTTTTATTGGTTGAGAATATAATTTTATTTTTTT
>LE_HBa0070N08_T7_15615 (trimmed for quality and cloning vector)
AGCTTGGATCAATCATACAATATTATCTCGTGATTTTTGTAAAGTCTCACCTAGCTAATAAAAAATATATTATTAAAAAACTTTGATGTAATAAATGAAA
GAAGAGTATTTTTTAACTTCGAACCTGTCGAAGATGATGGGAGTGTATATTCATTGCAATTCAAAAATTATAACAATCATAATGCATTTAATTTAAGAAA
TGAAAAGATATTAATGACTCAACTTAAACATATTTGATACAATTTCATAATTTTGAGAAAAGAGTACAAACAACTTGCCATGATACAACAATTAAACACA
TCAAAAAGCAATACAAAAAAAAAAGTCAAGAAACTCACAAACGTATCATAATGAATCGTAAACACAAAAACAAAGATGACCATAAACATTTAAACTTTAA
ACTCTCTCCTTAATAACAAGGAAAGAAATAACCAAACTGAAAAATCCAACCACCATTGAAGGCAATGAGGTGATTATGGCACCGGAGGATTGCGATGGAG
AGGGGGCGGGGGCGGGGGCATGGTGGTCATGGCCCTCATGAGCTATAACAACAGACGCTAAAAATACAACACAAGCAATGAAGTTGAATGCAACACTTGA
AACTTTGAAAGCCATTACTTTCTCGTTTTTCAAAATTCAAATATTGCCTTCAACTTGTTTTATTCTCAACTTGTTTTATTGGTTGAGAATATAATTTTAT
TTTTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.922171
Expected error %
0.173107
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0070N08
Clone
Clone name
hba-70n8
LE_HBa0070N08
P070N08
Clone type
BAC
Contamination
none
Estimated length
49,426
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found