Clone Read LE_HBa0070P03_T7_15701

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0070P03_T7_15701
Primer
T7
ID from Seq. Facility
LE_HBa_070_P03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
662 trimmed for vector and quality, 687 raw
Genbank Accession
Sequence
>LE_HBa0070P03_T7_15701 (raw untrimmed)
GGGGGAATCCTCCTAGAGTCGACCCTGCAGGCATGCAAGCTTTTGAAAGAGCGAAATAGTAAATTATCTTCTTATTTATGATTTCTTAATATGCATGTAA
AAAACAAGTGATCTACAAATATCAGATGGAGTGAATAATACTTTAGCTATTTTTAAGGGCAAAACATATCGTTAAACATTTAAACTTATCAGTATATTTT
ATTTACATATTCAAACTATTACATGCTTTAATTGAACATGTGATTAAATGTTTATTTTAGGCACTCTTTACTTAGATTTAAGGGTTAACAATTTATAAAA
GGTTATATGTAACATTAAAGAAAATGACATATTTTAAATTGTTAATTTATTCATAAAAATGAATACTTTGAGAACACACCTATAACTTTTACAAAATTTA
AGCTGAAAGTGATTAATTGCAATATTTTGCTATCATATATTTATATGCTCAATTCAAATAAATGTTGATTTGAGTGTCTAACTATAATATGATAGACAAA
TTAAGCGACTAATTTTGTGTGTTTTATTCTACTTTATAGTTCATATTAGATTAGTATATCAATTTCTAAATAATTTATATAAAATATATTTTATGCAAAT
AACAATTAAATATTACATTTTGTTAATGCTACAGTGTGAGCAAAATATCAAAAAGACAATCAAACATTTTATTATTAATGTTTGATG
>LE_HBa0070P03_T7_15701 (trimmed for quality and cloning vector)
TGCAGGCATGCAAGCTTTTGAAAGAGCGAAATAGTAAATTATCTTCTTATTTATGATTTCTTAATATGCATGTAAAAAACAAGTGATCTACAAATATCAG
ATGGAGTGAATAATACTTTAGCTATTTTTAAGGGCAAAACATATCGTTAAACATTTAAACTTATCAGTATATTTTATTTACATATTCAAACTATTACATG
CTTTAATTGAACATGTGATTAAATGTTTATTTTAGGCACTCTTTACTTAGATTTAAGGGTTAACAATTTATAAAAGGTTATATGTAACATTAAAGAAAAT
GACATATTTTAAATTGTTAATTTATTCATAAAAATGAATACTTTGAGAACACACCTATAACTTTTACAAAATTTAAGCTGAAAGTGATTAATTGCAATAT
TTTGCTATCATATATTTATATGCTCAATTCAAATAAATGTTGATTTGAGTGTCTAACTATAATATGATAGACAAATTAAGCGACTAATTTTGTGTGTTTT
ATTCTACTTTATAGTTCATATTAGATTAGTATATCAATTTCTAAATAATTTATATAAAATATATTTTATGCAAATAACAATTAAATATTACATTTTGTTA
ATGCTACAGTGTGAGCAAAATATCAAAAAGACAATCAAACATTTTATTATTAATGTTTGATG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.871918
Expected error %
0.144008
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0070P03
Clone
Clone name
hba-70p3
LE_HBa0070P03
C03HBa0070P03
P070P03
Clone type
BAC
Contamination
none
Estimated length
85,553
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found