Clone Read LE_HBa0071A12_SP6_15766

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0071A12_SP6_15766
Primer
SP6
ID from Seq. Facility
LE_HBa_071_A12-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
793 trimmed for vector and quality, 900 raw
Genbank Accession
Sequence
>LE_HBa0071A12_SP6_15766 (raw untrimmed)
CAGGAGTGGAAATTTTGATGGAAAATCAAACAGGGAAGAAGATCAAGAGGTTGCGATCTGATAATGGGCTGGAATTTTGCTGGTCTGAATTTGATCAATT
TTGTAAGGGTGAAGGGATTGCTCGACATCGTACAGTCAGAAATACACCACAGCAGAACGGTGTAGCTGAGCGGATGAATCAAAAACTTCTGGAGAGAGCA
AGGTGCATGCTCTCTAATGCTGGGCTAGATAGAAGATTCTGGACAAAAACGGTTAGTACAGCTTGCTACTTGGTTAACCGCGGAACACATACAGGCATAC
AGTGCAAGACACCTATGGAGATGTGGTCAGGAAAAGATGCTGATTATTCAAATCTGAAAGCTTTTGGTTGTACGGCTTACTATCACGTCAGTGAAGGTAA
GTTAGAACCAAGAGCTAAAAAGGGAGTATTTGTGGGCTACGGAGGTGGAGTGAAATGTTTCAGAATCCGGTCTCCAGCAGAAAAGAAGGTTATTATGAGC
AGGAACGTTGTCTTTCATGAAAGTTCTCTGCTTAGAACCATTGTGAAGCCTACAACTACGTCAGAAACTGGGAGTCTTGATAAACAGGTGGAGTTTCAAG
TCATTCAGAACGAGAGCGATTTGAAAGAACCTGAAGAGGAGGATCAAGAGCCACAGACAGAAACTGATATTCCAGAATCTATGCCATCAGATATCCATCA
GAGTATAGCTCAAGATCGGCCAAGGAGGGTTGGAGTCCGGCCACCTACGAAGTATGGTTTTGAGGACATGGTGGGTTATGCACTGCAGGTTGCTGAAGAG
GTAGATACATCTGAGCCGTCTACTTACAAAGAAGCCTTTTTAAGTCCTGATTTTGAAAAATGGTTTGCTGCTATGGGAAAAGAGATGGAGTCCCTAAACA

>LE_HBa0071A12_SP6_15766 (trimmed for quality and cloning vector)
GAGTGGAAATTTTGATGGAAAATCAAACAGGGAAGAAGATCAAGAGGTTGCGATCTGATAATGGGCTGGAATTTTGCTGGTCTGAATTTGATCAATTTTG
TAAGGGTGAAGGGATTGCTCGACATCGTACAGTCAGAAATACACCACAGCAGAACGGTGTAGCTGAGCGGATGAATCAAAAACTTCTGGAGAGAGCAAGG
TGCATGCTCTCTAATGCTGGGCTAGATAGAAGATTCTGGACAAAAACGGTTAGTACAGCTTGCTACTTGGTTAACCGCGGAACACATACAGGCATACAGT
GCAAGACACCTATGGAGATGTGGTCAGGAAAAGATGCTGATTATTCAAATCTGAAAGCTTTTGGTTGTACGGCTTACTATCACGTCAGTGAAGGTAAGTT
AGAACCAAGAGCTAAAAAGGGAGTATTTGTGGGCTACGGAGGTGGAGTGAAATGTTTCAGAATCCGGTCTCCAGCAGAAAAGAAGGTTATTATGAGCAGG
AACGTTGTCTTTCATGAAAGTTCTCTGCTTAGAACCATTGTGAAGCCTACAACTACGTCAGAAACTGGGAGTCTTGATAAACAGGTGGAGTTTCAAGTCA
TTCAGAACGAGAGCGATTTGAAAGAACCTGAAGAGGAGGATCAAGAGCCACAGACAGAAACTGATATTCCAGAATCTATGCCATCAGATATCCATCAGAG
TATAGCTCAAGATCGGCCAAGGAGGGTTGGAGTCCGGCCACCTACGAAGTATGGTTTTGAGGACATGGTGGGTTATGCACTGCAGGTTGCTGA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.968205
Expected error %
0.201267
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAX92941.1| Score 225 E Value 1e-57 Identity 15.90% Align. Length 779bp (98.23%) Frame 1
retrotransposon protein, putative, Ty1-copia sub-class [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT85194.1| Score 219 E Value 5e-56 Identity 15.60% Align. Length 779bp (98.23%) Frame 1
putative polyprotein [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0071A12
Clone
Clone name
hba-71a12
LE_HBa0071A12
P071A12
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found