Clone Read LE_HBa0005B19_SP6_1620

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0005B19_SP6_1620
Primer
SP6
ID from Seq. Facility
LE_HBa_005_B19-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
777 trimmed for vector and quality, 899 raw
Genbank Accession
Sequence
>LE_HBa0005B19_SP6_1620 (raw untrimmed)
AAAGGGGGTNCCGTTCACTATGTACATATTTCTCTACAAAGTAAATAAAAAATATTGAGATTTTACAATTCATTATAAAATAATAATAGTAGTATGTTGC
AACCGATGGATAGTCTGTAGTTATAAATTAACATTATGTTGCCACATATGTACTTGCTGTTGCGTAACATATCCATCTTATGTAGCAACAAATGCATCAT
ATGTTGATACATCTGTACATATTATTACAACATTTGAATCTTATGTGGCAACAGATGACCAACATATCAATTTCACAATTCATTATAAAATAATATTAGC
AGTATGTTGCAACCGATGGTTAGTCTGTTGCGATAAATTAACAATATGTTGCGACATATGTACCTGCTGTTGCGCAACATATACATCTTATGTAGCGACA
GATACATCATATGTTGACACATGTGTATAGATTATTGCAACATTTGAATCTTATGTGGCAACAGATGACCAACATATCACTAAAATGTGGCAACATACGC
TAAAATCATATCAACAAAATGACCAAAAAAAAGAACAAAAAGAGCTACAAAAATGACTTTTCACTGAATAATAACATTACAGATACATTTCCTCAAAATA
AGGATTTTTTGAGTTGGCTGATTTTCTTTCAAAAATGATAATAATACACACCATTAAGTCGATTATTCAGTTTTTACACCTACAGTTAATTTTATTATTT
ATTAATTCAAGAAAAAAACTTCGAAAATTGTAAAGTATTTCAAAAAATAACTTACTCATTTCTAGTCGAACACGGTACAAATCTAGATTGGAGAGTAATG
GAAGACTGAAGAGGAAGAATAACGACTGCACAGGAAGAATAACAACGGAACTTTTAAATTTTTTAAGGAAAGAAGAATGAAGGAAAATAAAAGTGAAGA
>LE_HBa0005B19_SP6_1620 (trimmed for quality and cloning vector)
TCTACAAAGTAAATAAAAAATATTGAGATTTTACAATTCATTATAAAATAATAATAGTAGTATGTTGCAACCGATGGATAGTCTGTAGTTATAAATTAAC
ATTATGTTGCCACATATGTACTTGCTGTTGCGTAACATATCCATCTTATGTAGCAACAAATGCATCATATGTTGATACATCTGTACATATTATTACAACA
TTTGAATCTTATGTGGCAACAGATGACCAACATATCAATTTCACAATTCATTATAAAATAATATTAGCAGTATGTTGCAACCGATGGTTAGTCTGTTGCG
ATAAATTAACAATATGTTGCGACATATGTACCTGCTGTTGCGCAACATATACATCTTATGTAGCGACAGATACATCATATGTTGACACATGTGTATAGAT
TATTGCAACATTTGAATCTTATGTGGCAACAGATGACCAACATATCACTAAAATGTGGCAACATACGCTAAAATCATATCAACAAAATGACCAAAAAAAA
GAACAAAAAGAGCTACAAAAATGACTTTTCACTGAATAATAACATTACAGATACATTTCCTCAAAATAAGGATTTTTTGAGTTGGCTGATTTTCTTTCAA
AAATGATAATAATACACACCATTAAGTCGATTATTCAGTTTTTACACCTACAGTTAATTTTATTATTTATTAATTCAAGAAAAAAACTTCGAAAATTGTA
AAGTATTTCAAAAAATAACTTACTCATTTCTAGTCGAACACGGTACAAATCTAGATTGGAGAGTAATGGAAGACTGA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.924062
Expected error %
0.101705
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0005B19
Clone
Clone name
hba-5b19
LE_HBa0005B19
P005B19
Clone type
BAC
Contamination
none
Estimated length
88,378
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found