Clone Read LE_HBa0005B19_T7_1621

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0005B19_T7_1621
Primer
T7
ID from Seq. Facility
LE_HBa_005_B19-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
754 trimmed for vector and quality, 887 raw
Genbank Accession
Sequence
>LE_HBa0005B19_T7_1621 (raw untrimmed)
CTCGGGTCCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAGACTCTTTCTCCAAGTCTTGGTCTTTCCTCATGTTCGGGACGCTATCAAT
TATATTCCAACTTTTGATGACTTCAATAGATATTAGGAATACCCTATTTTCATCATGTTTCTTTGGATTCTTTTATATTAAGGCCAATATGACATATTGA
TTATGTAAAGGCTAAGTCCAAATTTGTACTCTTTAGATGATTTTATATATGTGAGACAATTTCTTAGAATATCATATGATTTATGAATGATAAATATGAA
GTCTAACTATACTTCAAGTAGAATGTAATAGTTTTAATTTTCCTCAATATTTATTGATCACGTGTTATGACGAATTAAGGGCTTGTCGAGTCCTCTGAGA
AGACGACGACACCGGTCTCATCTGGGATATGTGCTACGGGTTTGACATCTCAAAACCCGAACCACCATCGTATGAGATCAAAATTAACTTATATGGCTAA
TTGCGGTGACAAAATTTTAATTTGAGCATGATTATTCAGAGGCATAATAAATATATTAGACCCTAAACTTGGCTTCAAATTTTAACTTTGAACTTCAACT
TTCATAATCAACAAACAAGCACTTTAACTATCCAACTTTTAAATAAATAAACACATGAGCCCTACATGACACAATACACGTAGGACACCACGTAGGAAAA
AAAATGACATGTAGGATATGTGTGTCTATTTGTTCAACTTTATACAAGTTTATGTGTCTACTTGTGCACACCCCCAGTTGAAGGGCATAAATGTAATTCG
AATTCAAGTTAAAGGACATATTTATGTATTTTGCCTTACCAAAATATTGACTAAAGTGAAATTTTGATCAAAACTTAAAAGTTAAAA
>LE_HBa0005B19_T7_1621 (trimmed for quality and cloning vector)
AGCTTGAGACTCTTTCTCCAAGTCTTGGTCTTTCCTCATGTTCGGGACGCTATCAATTATATTCCAACTTTTGATGACTTCAATAGATATTAGGAATACC
CTATTTTCATCATGTTTCTTTGGATTCTTTTATATTAAGGCCAATATGACATATTGATTATGTAAAGGCTAAGTCCAAATTTGTACTCTTTAGATGATTT
TATATATGTGAGACAATTTCTTAGAATATCATATGATTTATGAATGATAAATATGAAGTCTAACTATACTTCAAGTAGAATGTAATAGTTTTAATTTTCC
TCAATATTTATTGATCACGTGTTATGACGAATTAAGGGCTTGTCGAGTCCTCTGAGAAGACGACGACACCGGTCTCATCTGGGATATGTGCTACGGGTTT
GACATCTCAAAACCCGAACCACCATCGTATGAGATCAAAATTAACTTATATGGCTAATTGCGGTGACAAAATTTTAATTTGAGCATGATTATTCAGAGGC
ATAATAAATATATTAGACCCTAAACTTGGCTTCAAATTTTAACTTTGAACTTCAACTTTCATAATCAACAAACAAGCACTTTAACTATCCAACTTTTAAA
TAAATAAACACATGAGCCCTACATGACACAATACACGTAGGACACCACGTAGGAAAAAAAATGACATGTAGGATATGTGTGTCTATTTGTTCAACTTTAT
ACAAGTTTATGTGTCTACTTGTGCACACCCCCAGTTGAAGGGCATAAATGTAAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.951405
Expected error %
0.438571
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0005B19
Clone
Clone name
hba-5b19
LE_HBa0005B19
P005B19
Clone type
BAC
Contamination
none
Estimated length
88,378
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found