Clone Read LE_HBa0073I22_T7_16939

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0073I22_T7_16939
Primer
T7
ID from Seq. Facility
LE_HBa_073_I22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
163 trimmed for vector and quality, 802 raw
Sequence
>LE_HBa0073I22_T7_16939 (raw untrimmed)
GGGGGGATTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCGGTCTTATTGATATTATTCAGAACATTTAAATGAGAGAGTTTTAGAGNTTAAGAATAT
AATTTAAGCCTTTAATAGCAGGTAAAATGAGTGAAAATNAGATGGTTTANAATAAGTTGATATAAGATTATTTATAGATAAGNTTTCCAGAAAAAGTTNT
ATGGANTAGNTNATAGTAAGTTTATGAGTTGGANANTTATTTNAGTTATGTGANGAATGGTAGAGATNTNTGGNTNTTTNTGNAATGANTGANAGAGATN
TNAGGGTNTTTNNANTATGGNTGGATNNNTGAANTTATNTNAATGTTAGNTTGTTTGGTNANAATTTGGTGGGTGGTNNNTTATTNTTAGAGNTAGGTTG
TNTTNANAGTTATGAATTTGGTTTAGATTGTATTGAATGGGGATTTTTGATTGATAAGATTTNNNNTTANTGGTNATTTGGTGTTGTTGATGATGNGTNA
NTTTTGATNTATTNTTTTTGTNANGTGTNATTTTTTGATTGTATNAAGTATTAAGTGGAANTTTTATNNNATAGAGTTAAANTGTGTGAAATTTATTTTT
NATTTTATGTGTATGGTGTATGAATTTTATATGTTGGTTTAGTGTTTTTTTTAAAGTAGTTATGATATTTNTTAATTGGTTTAATGATTTGGTTAATTTT
ATAGGAGAGATTTAATTGAAATTTTTGTGGGGTAGAAGGAAAGAAAGTAGGGTTGGATTTATAGTATTTGTGGGGGTTTTAAATAAATATTGGAAGGTTA
AT
>LE_HBa0073I22_T7_16939 (trimmed for quality and cloning vector)
TAGAGTCGACCTGCAGGCATGCAAGCTTCGGTCTTATTGATATTATTCAGAACATTTAAATGAGAGAGTTTTAGAGNTTAAGAATATAATTTAAGCCTTT
AATAGCAGGTAAAATGAGTGAAAATNAGATGGTTTANAATAAGTTGATATAAGATTATTTATA

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.908403
Expected error %
6.85493
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0073I22
Clone
Clone name
hba-73i22
LE_HBa0073I22
P073I22
Clone type
BAC
Contamination
none
Estimated length
94,941
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found