Clone Read LE_HBa0073O15_T7_17213

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0073O15_T7_17213
Primer
T7
ID from Seq. Facility
LE_HBa_073_O15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
642 trimmed for vector and quality, 822 raw
Genbank Accession
Sequence
>LE_HBa0073O15_T7_17213 (raw untrimmed)
TCCGGTTCCCGGGGGGATCCTCCTAGAGTCGACCTGCAGGCATGCAAGCTTATAAAAGAAATGCGCGATCAATTTCTTCCTAGCAATGCATCTTGGCTTG
CAAGGGACAAATTGAAAAGGTTAAGGCAGACGGGTTCAGTGAGGGAATATATAAAAGAATTTACCTCTGTGATGTTAGACATACAAAATATGTCTGATGA
GGATAAACTTCACAATTTCATTTCGGGCATGCAAGGCTGGGCTCAAAACGAATTACGAAGGCAGAATGTTAAAGATCTGCCTGGGGCAATTGCTGCTGCT
AATTCATTGGTAGATTTCCGGACGACTCGTCCTTCGACAGATGTCCCTTCTACTTCAAAGAATAAGAAAAAGAACGAGAAAAAAGGGGAATGGAGAAAGG
ATAGTCGTAAAGAGAATACAAATGATAAAGGAAAGGCACAAATGAATGATGTGAAAGACAGACCCAAGAGTAAAGATGGAAACTCTAAGGGATGTTGGAC
TTGTGGTGGTCCTCATTTGGCCAAATCTTGTCCAAACCGGGAAAAGGTGAATGCTATGCTTGCTGGAAGTATGAATCAAAGAGAGGAGGATGAAGAAATT
ATGGCTGCAATGGCAAACCCATTGGGATTGTCTTTTAATCACATTATGGGGATGAACCCTGTTGGGGAAATCTCCAGCACTTCGAATCCTCATGCTTTCT
TAATTCATAATCAAATGAAAGTAAAAAAACAATGTGTGATGGCAATGGGTTGATACAGGGGCCCCCAACCCCGTTTGTTTTTGGTGAAGGGTTGCTGCTA
AAATTTGGGGGCTAAAGTTGTC
>LE_HBa0073O15_T7_17213 (trimmed for quality and cloning vector)
ACCTGCAGGCATGCAAGCTTATAAAAGAAATGCGCGATCAATTTCTTCCTAGCAATGCATCTTGGCTTGCAAGGGACAAATTGAAAAGGTTAAGGCAGAC
GGGTTCAGTGAGGGAATATATAAAAGAATTTACCTCTGTGATGTTAGACATACAAAATATGTCTGATGAGGATAAACTTCACAATTTCATTTCGGGCATG
CAAGGCTGGGCTCAAAACGAATTACGAAGGCAGAATGTTAAAGATCTGCCTGGGGCAATTGCTGCTGCTAATTCATTGGTAGATTTCCGGACGACTCGTC
CTTCGACAGATGTCCCTTCTACTTCAAAGAATAAGAAAAAGAACGAGAAAAAAGGGGAATGGAGAAAGGATAGTCGTAAAGAGAATACAAATGATAAAGG
AAAGGCACAAATGAATGATGTGAAAGACAGACCCAAGAGTAAAGATGGAAACTCTAAGGGATGTTGGACTTGTGGTGGTCCTCATTTGGCCAAATCTTGT
CCAAACCGGGAAAAGGTGAATGCTATGCTTGCTGGAAGTATGAATCAAAGAGAGGAGGATGAAGAAATTATGGCTGCAATGGCAAACCCATTGGGATTGT
CTTTTAATCACATTATGGGGATGAACCCTGTTGGGGAAATCT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.964494
Expected error %
0.288324
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD13304.1| Score 384 E Value 1e-106 Identity 30.10% Align. Length 626bp (97.51%) Frame 1
polyprotein [Lycopersicon esculentum] pir||T17459 polyprotein - tomato
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0073O15
Clone
Clone name
hba-73o15
LE_HBa0073O15
P073O15
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found