Clone Read LE_HBa0076B20_SP6_17366

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0076B20_SP6_17366
Primer
SP6
ID from Seq. Facility
LE_HBa_076_B20-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
623 trimmed for vector and quality, 754 raw
Genbank Accession
Sequence
>LE_HBa0076B20_SP6_17366 (raw untrimmed)
GGAAAATTTGAAGATACCCTTTTGGTACCGACTTTATGAGGTTGCTAGAAGCTGAGGAGTCCTTTGTACATTTCCCACTACTTAGATCAATGACGTTACC
ACTAACCCAGCTAAGGTAAAGGCGATTGATATAATTCCGAAGCTTTGTATCCTTCGCTAAATCTCCACCAAGCACATGGAGGGTGAAATCAATGCCTAGA
TGATTGCACGCCTGTGCAAAAATGCATCCAGTCATGAATGCATCATAGCCAGCTTCATGCTTGGCTCCTGAGTTCCAGTTCGAGGATCTGCAAATCAACT
TAAAAAATTAGTGACAAGGATTATTCACATTGTTCTTTTTGATTTATAAATCGAGATGCGGCTCAATAGGTTAATGCTATAGGAGTGCTGAAAGAGGCGA
AAAATTTTCTTCACAATCCTAATCAAATACACCAAGATGCAAAGCAAACACAGTTGAGACACACATAACATCACAGTGTCATATGCATACAGAACTCCAA
CAGGAGAAAAAGAAAGATGTGCGTAAAAGATGTAGATCAAAATCAATTGCCACGCTAGAAACAGTCGGGCAAATGGAAATGGTAAGCACGCAGTGAAATA
ACAAATTGCATTCATGTAGATTTCAGTCTCAAGAGTAGTGTGGGATTGGTGGTAACCTTTTTTCATCTACTTGAACCTCCACTTCTAAACACTGGTTCTA
TTCTCCCAAATTATATGTTTTGGTTCCTAAAGCAATTTTGATGAACAGATTTAA
>LE_HBa0076B20_SP6_17366 (trimmed for quality and cloning vector)
AGGTTGCTAGAAGCTGAGGAGTCCTTTGTACATTTCCCACTACTTAGATCAATGACGTTACCACTAACCCAGCTAAGGTAAAGGCGATTGATATAATTCC
GAAGCTTTGTATCCTTCGCTAAATCTCCACCAAGCACATGGAGGGTGAAATCAATGCCTAGATGATTGCACGCCTGTGCAAAAATGCATCCAGTCATGAA
TGCATCATAGCCAGCTTCATGCTTGGCTCCTGAGTTCCAGTTCGAGGATCTGCAAATCAACTTAAAAAATTAGTGACAAGGATTATTCACATTGTTCTTT
TTGATTTATAAATCGAGATGCGGCTCAATAGGTTAATGCTATAGGAGTGCTGAAAGAGGCGAAAAATTTTCTTCACAATCCTAATCAAATACACCAAGAT
GCAAAGCAAACACAGTTGAGACACACATAACATCACAGTGTCATATGCATACAGAACTCCAACAGGAGAAAAAGAAAGATGTGCGTAAAAGATGTAGATC
AAAATCAATTGCCACGCTAGAAACAGTCGGGCAAATGGAAATGGTAAGCACGCAGTGAAATAACAAATTGCATTCATGTAGATTTCAGTCTCAAGAGTAG
TGTGGGATTGGTGGTAACCTTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.967951
Expected error %
0.908916
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g55870.1 Score 113 E Value 7e-26 Identity 21.80% Align. Length 233bp (37.40%) Frame 1
68414.m06407 CAF1 family ribonuclease contains Pfam domain, PF04857: CAF1 family ribonuclease
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_175983.2| Score 113 E Value 3e-24 Identity 21.80% Align. Length 233bp (37.40%) Frame 1
CAF1 family ribonuclease [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
sp|Q9LG26|PARN_ARATH Score 113 E Value 3e-24 Identity 21.80% Align. Length 233bp (37.40%) Frame 1
Poly(A)-specific ribonuclease PARN (Polyadenylate-specific ribonuclease) (AtPARN)
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0076B20
Clone
Clone name
hba-76b20
LE_HBa0076B20
P076B20
Clone type
BAC
Contamination
none
Estimated length
72,485
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found