Clone Read LE_HBa0076C17_T7_17409

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0076C17_T7_17409
Primer
T7
ID from Seq. Facility
LE_HBa_076_C17-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
559 trimmed for vector and quality, 771 raw
Genbank Accession
Sequence
>LE_HBa0076C17_T7_17409 (raw untrimmed)
TAGCTAATGTAACCTCAACCTCTAGAGGTAGAAGTAAGGTTTACCAACACTCTACCCTCCTTAGACCCCACTGTGTCGGACAATACTGGGTATGTTGCTG
TAACAGCCTTTACATCAGGAATTAGAATTTGAATGGAATTGGATTTTGCCATACCTTGCTCAACAATAGATAACATTAAAACAGATAGACTTAGGTTTAA
GAGTGGTTTTAGGAGGGTTAATAGTAGTGAGAGTATAAGGGGGAATTCATTGTAGAATGCTTTTGATCAGAACAACCCCCACACCCCTCGCAATAAGATA
ACATCCTTCCTTGCCTACTTTAGTAGCCATGTTGTCAAAGTATGAGATTTTCTTCCTTCCCACGCAAATTGGGATCCAAGATATGTACGGAAGGGAAGCT
TTTCTCTATGTAACTTGTACAATCTCTCACCCTGTTAATCCTATAGGCACTGGCTTTGGGATCACTGAGAAAGAAGCTTTTGTTGGAGTTGATTCTTCAT
CTGAACATTTCATGATAGCAAACTAGATCTCCTATGTAATCATTCCCACCGACAAGATCATGCATGCAAGTTTTTAATCCTTTTCAGTGTCATTCATAAA
GATACACAGTGATAGACACAAATTTTTGAAGAACTTCTTCGATCCAAGAAATAACACCGTCCTATCAATCCCCACCTTACTTGCATTTTTTATGAAAAAA
TTGCCAAAAATTGGAGAATTAAATAGGCCCTCAATGCTCCATAATCCAAGCCTCAAAATGCAAAACTTGAA
>LE_HBa0076C17_T7_17409 (trimmed for quality and cloning vector)
GGTAGAAGTAAGGTTTACCAACACTCTACCCTCCTTAGACCCCACTGTGTCGGACAATACTGGGTATGTTGCTGTAACAGCCTTTACATCAGGAATTAGA
ATTTGAATGGAATTGGATTTTGCCATACCTTGCTCAACAATAGATAACATTAAAACAGATAGACTTAGGTTTAAGAGTGGTTTTAGGAGGGTTAATAGTA
GTGAGAGTATAAGGGGGAATTCATTGTAGAATGCTTTTGATCAGAACAACCCCCACACCCCTCGCAATAAGATAACATCCTTCCTTGCCTACTTTAGTAG
CCATGTTGTCAAAGTATGAGATTTTCTTCCTTCCCACGCAAATTGGGATCCAAGATATGTACGGAAGGGAAGCTTTTCTCTATGTAACTTGTACAATCTC
TCACCCTGTTAATCCTATAGGCACTGGCTTTGGGATCACTGAGAAAGAAGCTTTTGTTGGAGTTGATTCTTCATCTGAACATTTCATGATAGCAAACTAG
ATCTCCTATGTAATCATTCCCACCGACAAGATCATGCATGCAAGTTTTTAATCCTTTTC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.962276
Expected error %
0.113198
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0076C17
Clone
Clone name
hba-76c17
LE_HBa0076C17
P076C17
Clone type
BAC
Contamination
none
Estimated length
116,017
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found