Clone Read LE_HBa0076F15_SP6_17548

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0076F15_SP6_17548
Primer
SP6
ID from Seq. Facility
LE_HBa_076_F15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
551 trimmed for vector and quality, 810 raw
Genbank Accession
Sequence
>LE_HBa0076F15_SP6_17548 (raw untrimmed)
AAAATGGCGCCTCCGCCGTTACCTGTCCTACTGCTCTCTTCATTCTCAGAAGGCTGAAAAGCACGTGGCACGGGCTTTAAAGAAAGCAGGACTTAATGCC
TCTAACCCAAGTAAAATAGTCCCCAAGTTTCATGTTATAGTTGCGGAATGTGTTAGCCAGATCCAAAACAGAAGAAGAGCTGCACAAAAAGCAACTCTAG
AGATGGCCGAGGTGAAAGAGGAGAGCAGCTGTTAATGCCCGAGCATCACGTAAAACTGAAGCCTGTATATTTTCTTGGCAAGTTGGTGATGCAACTATAA
CAAAGTATATTTGGTTAAATAGGATTTTGTGTGGGAAGAAGACAGGAGTTATGACTTGGAAGAAAAAAGCTTGTATGTAAAGAAGGGTACTGCAAACTAA
CCAAATATCGTCTAATATTGTTGAGCTACATTTGTTCATTATGTTGGTGTTCTTGTTTGTGAATCATGCAATGTTGTGGAAAATTATGTAACAAGAAACA
TACAACAATTTCAGTTGTATTTTAAACTCAATATTTTTGTTAAAAATAAAGTTCATTTTTTGAACCTGACATCTGCTAATGGTTGCAGCAATTCTTGCTG
CACTGTTTGTATTTTTTTGGCTCCCAGATAGAATTTGATATTGTGTATGCCTTTAGTCTTATTGGATATAGACAAATACTCCTTTTCATTCTTTTCAAAA
GATTCGGTATTAGGCTTTTCGCCCTCATCCTGGTCCAGGGGCCTGGTTTCCTTTCCCGTGTAGGTGTGCAGGACTACCATCAATAAGCATTCACGGGCTC
TTTAAGCCAT
>LE_HBa0076F15_SP6_17548 (trimmed for quality and cloning vector)
CCTACTGCTCTCTTCATTCTCAGAAGGCTGAAAAGCACGTGGCACGGGCTTTAAAGAAAGCAGGACTTAATGCCTCTAACCCAAGTAAAATAGTCCCCAA
GTTTCATGTTATAGTTGCGGAATGTGTTAGCCAGATCCAAAACAGAAGAAGAGCTGCACAAAAAGCAACTCTAGAGATGGCCGAGGTGAAAGAGGAGAGC
AGCTGTTAATGCCCGAGCATCACGTAAAACTGAAGCCTGTATATTTTCTTGGCAAGTTGGTGATGCAACTATAACAAAGTATATTTGGTTAAATAGGATT
TTGTGTGGGAAGAAGACAGGAGTTATGACTTGGAAGAAAAAAGCTTGTATGTAAAGAAGGGTACTGCAAACTAACCAAATATCGTCTAATATTGTTGAGC
TACATTTGTTCATTATGTTGGTGTTCTTGTTTGTGAATCATGCAATGTTGTGGAAAATTATGTAACAAGAAACATACAACAATTTCAGTTGTATTTTAAA
CTCAATATTTTTGTTAAAAATAAAGTTCATTTTTTGAACCTGACATCTGCT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.950066
Expected error %
0.331253
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g31600.1 Score 67 E Value 8e-12 Identity 17.70% Align. Length 197bp (35.75%) Frame 1
68415.m03860 expressed protein
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0076F15
Clone
Clone name
hba-76f15
LE_HBa0076F15
P076F15
Clone type
BAC
Contamination
none
Estimated length
126,087
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found