Clone Read LE_HBa0076M13_SP6_17880

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0076M13_SP6_17880
Primer
SP6
ID from Seq. Facility
LE_HBa_076_M13-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
261 trimmed for vector and quality, 652 raw
Genbank Accession
Sequence
>LE_HBa0076M13_SP6_17880 (raw untrimmed)
TCCTCCGGATCAATCGTGATTGGGCATTATTGAGTTCATACGTAATGTCTTTTNGGACCTACGAATGCCCCTGTCGCTTTTATGAGCTTGATGAATGGGA
TTTTTAAGACATATCTAGATCTCTTTGTCATTGTATTCATTGATGATATACTGTTATACTCAAAGAGCAAGAAAGAACATGAGGAGCACTTGAGAATTGT
GTTGGAAATATTGAGGGAGAGAAAGCTTTATGCCAAATTCTCTAAGTGTGAGTTTTGGCTAGATTCAGTGTCCTTTTTGGGACACGTGGTTTCTAAGGAT
GGAGTTATGGTGGATCCATCTTAGATTGACGCAGTGAAGAATTGGGAGAGACCTACTAATGTGTCAGAAGTAAGGAACTTTTGTAGGTTTACATAGACTC
TACCGCCGATTTGTCCATATGTTCTTTTCTTTTTCCTTCCAAATTGACCACTTTTGAACAACTCAATGTTCCCCTCCCTTGCCCAAACGACTGTGAAATA
ATGCGTTCTTAATTTCCATTACTTGGTCGCCTGCTTTCCGAGTTCTCCCTGTTTCCCCTGGATTGTACTCTTACCCCTGCCACCTGTAATGCAGCGCCTT
CTTGAAGACGGATCGCGCCACATCGTATAGTAGCAACGTCTCGCCCAGGTTC
>LE_HBa0076M13_SP6_17880 (trimmed for quality and cloning vector)
GGACCTACGAATGCCCCTGTCGCTTTTATGAGCTTGATGAATGGGATTTTTAAGACATATCTAGATCTCTTTGTCATTGTATTCATTGATGATATACTGT
TATACTCAAAGAGCAAGAAAGAACATGAGGAGCACTTGAGAATTGTGTTGGAAATATTGAGGGAGAGAAAGCTTTATGCCAAATTCTCTAAGTGTGAGTT
TTGGCTAGATTCAGTGTCCTTTTTGGGACACGTGGTTTCTAAGGATGGAGTTATGGTGGAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.944702
Expected error %
0.21705
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 138 E Value 4e-32 Identity 23.80% Align. Length 260bp (99.62%) Frame 2
putative polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV31171.1| Score 135 E Value 5e-31 Identity 23.40% Align. Length 260bp (99.62%) Frame 2
putative polyprotein [Solanum tuberosum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0076M13
Clone
Clone name
hba-76m13
LE_HBa0076M13
C03HBa0076M13
P076M13
Clone type
BAC
Contamination
none
Estimated length
115,674
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found