Clone Read LE_HBa0076M13_T7_17881

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0076M13_T7_17881
Primer
T7
ID from Seq. Facility
LE_HBa_076_M13-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
593 trimmed for vector and quality, 781 raw
Genbank Accession
Sequence
>LE_HBa0076M13_T7_17881 (raw untrimmed)
AAATTTGTGAAATCATACTTCACCTCTTTTCAAACATTAAACTCAACTCAAGGATACTCAAAACTACTAAACTTACTCAACTCAGAAGTACTCAAGGATA
ATATATTCAACTTAGAGATTACATAAAAGATATGTAATCTCTAATATCAAGGATAATATACTCAACTCAAAGATTAAATATTCTACTTAAAAGATATGAT
ACTCGACTCACTGAAGCACAGATCAAATCAAGATTCTCAACTTAAGGTACTCAACTCAAAATACTCAACTTTTGATACTCAACTTAACTCATTTCAATAT
AAAGTAGTTAAAACAAGTGTAATTAGAAAAGTGGTTTAAAAACACGATGTCAACATTGGTTATATAATAAGGATACAACATAACTCTTAAATGTATATGA
AAATACATTTAACCGATGTATATAAAAGTACAATAACATATGTGAGAGTTTCTCTAACCGACAACCATCACATAAGAGCTATAATGATGATACGTATATC
TATCTAATGCTACCAGCACATCTTATACCCTGCCAAAGGTTTAGGACCTGAACTACTAATGGATCCAGTAGTCTATGTGAAAAGGGTTCATCTAAAAAGT
TGACCTTTTTGGCCCATGATGTCTACATGGTTTATGGGGATTTTGAGTTGTCCTCAACTCTCCCCCCTATTCCTGCCTCTTTTTACTCCCCAAACTCTAC
TACCTCCTTACGACTTCAAAAACCTATTTGCTATCGGCATCTGGGATTTGGGGCTAACGATAAAACCCTTTCTTCGCCTTC
>LE_HBa0076M13_T7_17881 (trimmed for quality and cloning vector)
CTCTTTTCAAACATTAAACTCAACTCAAGGATACTCAAAACTACTAAACTTACTCAACTCAGAAGTACTCAAGGATAATATATTCAACTTAGAGATTACA
TAAAAGATATGTAATCTCTAATATCAAGGATAATATACTCAACTCAAAGATTAAATATTCTACTTAAAAGATATGATACTCGACTCACTGAAGCACAGAT
CAAATCAAGATTCTCAACTTAAGGTACTCAACTCAAAATACTCAACTTTTGATACTCAACTTAACTCATTTCAATATAAAGTAGTTAAAACAAGTGTAAT
TAGAAAAGTGGTTTAAAAACACGATGTCAACATTGGTTATATAATAAGGATACAACATAACTCTTAAATGTATATGAAAATACATTTAACCGATGTATAT
AAAAGTACAATAACATATGTGAGAGTTTCTCTAACCGACAACCATCACATAAGAGCTATAATGATGATACGTATATCTATCTAATGCTACCAGCACATCT
TATACCCTGCCAAAGGTTTAGGACCTGAACTACTAATGGATCCAGTAGTCTATGTGAAAAGGGTTCATCTAAAAAGTTGACCTTTTTGGCCCA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.921423
Expected error %
0.227671
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0076M13
Clone
Clone name
hba-76m13
LE_HBa0076M13
C03HBa0076M13
P076M13
Clone type
BAC
Contamination
none
Estimated length
115,674
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found