Clone Read LE_HBa0076N16_SP6_17934

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0076N16_SP6_17934
Primer
SP6
ID from Seq. Facility
LE_HBa_076_N16-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
712 trimmed for vector and quality, 821 raw
Genbank Accession
Sequence
>LE_HBa0076N16_SP6_17934 (raw untrimmed)
TAGGGTGGATTTGGTTAGTTTTAGAAAGTTGGATAACTCAGTAAACTAAAGACACCATCAACTAAGATGCATCCTTCTACCAGTCAACCGAGCTACTAGT
ACAAAACAAGGAGTGACATATTAAAGACGAGTTACCAGAAAACCAGAGACATACCAATGCCTTCACGGATGGACATGTTTGGTTTTATGACATCATTGGC
GTTAACCAGGAGTACATCACCAATGTACAAATGGTTTGTAGGGACAAAAACACTATACAATTCTTCATCCCCTTCTTCTGTCTGCCATCCAGAAATAATG
TGTCAATGTACATATATCAGCCAACAATATTATTAAATGCTCTTTTCTGTGTTCTATTATTGTTGTTCTTTCTACTTCTCGTCTTTCATCTCTATCAAGT
CACCGGAGAGAATATGAGGAGCTTATCTTTGAAAAATGTCAGTAGTTCAAGAAAGAACTTATGCACATCAAAAGAACATTCAGCACTGCACAGCAGCAAA
AGAAAATATGCATTTCTGAAAATAATAAGAAGGATGGTTTTTTCCCTATTGCAGTAATAAGGGAAAACTTGCTACAGCGAACAAATACCTGAAGGGTAAC
TGATGATGTTATAAAACCAAAAGCATATTCCCCCACACGGGGATGACGAATAATTGCCACTTCCTTAAAAGCGGTGGTGTTTTGATCTGTAGATTATATA
CGAATAAAAGTAAGTATCAAGAACAAGTAAAAAGAGAATACCGCCAAACCAAAATACTCCAGGTAGCACCCTCAACCTCTCAAAATAAAGTACTTATTTC
TTTATCTTCCAAACACAATTT
>LE_HBa0076N16_SP6_17934 (trimmed for quality and cloning vector)
TAGTTTTAGAAAGTTGGATAACTCAGTAAACTAAAGACACCATCAACTAAGATGCATCCTTCTACCAGTCAACCGAGCTACTAGTACAAAACAAGGAGTG
ACATATTAAAGACGAGTTACCAGAAAACCAGAGACATACCAATGCCTTCACGGATGGACATGTTTGGTTTTATGACATCATTGGCGTTAACCAGGAGTAC
ATCACCAATGTACAAATGGTTTGTAGGGACAAAAACACTATACAATTCTTCATCCCCTTCTTCTGTCTGCCATCCAGAAATAATGTGTCAATGTACATAT
ATCAGCCAACAATATTATTAAATGCTCTTTTCTGTGTTCTATTATTGTTGTTCTTTCTACTTCTCGTCTTTCATCTCTATCAAGTCACCGGAGAGAATAT
GAGGAGCTTATCTTTGAAAAATGTCAGTAGTTCAAGAAAGAACTTATGCACATCAAAAGAACATTCAGCACTGCACAGCAGCAAAAGAAAATATGCATTT
CTGAAAATAATAAGAAGGATGGTTTTTTCCCTATTGCAGTAATAAGGGAAAACTTGCTACAGCGAACAAATACCTGAAGGGTAACTGATGATGTTATAAA
ACCAAAAGCATATTCCCCCACACGGGGATGACGAATAATTGCCACTTCCTTAAAAGCGGTGGTGTTTTGATCTGTAGATTATATACGAATAAAAGTAAGT
ATCAAGAACAAG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.962563
Expected error %
0.216994
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g43130.1 Score 70 E Value 1e-12 Identity 69.80% Align. Length 537bp (75.42%) Frame 1
68414.m04968 expressed protein contains Pfam domain, PF04367: Protein of unknown function (DUF502)
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g20130.1 Score 67 E Value 7e-12 Identity 76.30% Align. Length 537bp (75.42%) Frame 1
68415.m02352 expressed protein contains Pfam domain, PF04367: Protein of unknown function (DUF502)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_915654.1| Score 73 E Value 8e-12 Identity 24.00% Align. Length 128bp (17.98%) Frame 1
P0677H08.7 [Oryza sativa (japonica cultivar-group)] dbj|BAB89792.1| membrane protein COV-like [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV59306.1| Score 70 E Value 4e-11 Identity 23.30% Align. Length 128bp (17.98%) Frame 1
unknown protein [Oryza sativa (japonica cultivar-group)] ref|XP_475304.1| unknown protein [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0076N16
Clone
Clone name
hba-76n16
LE_HBa0076N16
P076N16
Clone type
BAC
Contamination
none
Estimated length
75,136
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found