Clone Read LE_HBa0005F12_SP6_1798

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0005F12_SP6_1798
Primer
SP6
ID from Seq. Facility
LE_HBa_005_F12-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
754 trimmed for vector and quality, 910 raw
Genbank Accession
Sequence
>LE_HBa0005F12_SP6_1798 (raw untrimmed)
AATGGGTTTTCGNNTCACTGTGAAACGGGTTGANNAACTTCATGGCGTCTGCAGTTGGAGAAACGTCTAAGGGTAATACACTTGAATTAAGCCAATCTTG
CATTTCCTTTTCCTGCAAGATACATAAAGCAAGAGGAGAATTAATCTGAAAATCAGTGGGGAACAAAATATTACTTGAAAGCTAAATATAATTGCCACTT
TTGACCTTGTGGATTATGATAAGTTGTCCATTTTGAGAAAGGGACACTGTTTGATGCATTATTTAACAGACGGACTTGGAAGAGGCAAAGAGCCAGGAAA
TAGCAAAGCTGAAGAATACCTTGGAAGATGCGCAGAGCAAAGTGGATCAAACGAATGCACTGCTCATCAAGGAACGTGAGACTGCTCAGAAAGCAATTGA
AGAAGCAACCTCTATCGTGGAAGAGAAGCCGGTTCTTGTTGAAGATACAGAAAAGATTGATGCTTTAAATGCAGAAGTGGAAAATTTAAAGGTACCGACA
CTGAACTCGTAGAATTAACTCTAAGTGCTCCCAACCTGATGTTCCCCCATTAAAGAACAAAGGAAAGAAAAATACAGAATTTGTGTGTAAGTTCCATCTT
TTTTCCACTAACATATGGTTGATAGTTTCATGCTGATACCTTTATATAGGTGTTATTGCAATCTGAAAAGCAACGTGCTGATGAGATAGAAAAGAAACGT
GCTGACTCGCAAGAATCAAGTGAAGAAAAGCACAAGAAGTTGGAAGAAACTGAAAAAAAAGTTCAACAATATCAGGAATCAATGAGCAGGTAGCTACTCG
AATAAATTGATACCTGTTTTACTCCTTATCTACTGTAAAAATTGAAGATCACCCAACCTTTTTGTTCCAAAAATTCAAAAAAAAATTACTTAAAAGTACA
AAAATTTGTC
>LE_HBa0005F12_SP6_1798 (trimmed for quality and cloning vector)
TGGCGTCTGCAGTTGGAGAAACGTCTAAGGGTAATACACTTGAATTAAGCCAATCTTGCATTTCCTTTTCCTGCAAGATACATAAAGCAAGAGGAGAATT
AATCTGAAAATCAGTGGGGAACAAAATATTACTTGAAAGCTAAATATAATTGCCACTTTTGACCTTGTGGATTATGATAAGTTGTCCATTTTGAGAAAGG
GACACTGTTTGATGCATTATTTAACAGACGGACTTGGAAGAGGCAAAGAGCCAGGAAATAGCAAAGCTGAAGAATACCTTGGAAGATGCGCAGAGCAAAG
TGGATCAAACGAATGCACTGCTCATCAAGGAACGTGAGACTGCTCAGAAAGCAATTGAAGAAGCAACCTCTATCGTGGAAGAGAAGCCGGTTCTTGTTGA
AGATACAGAAAAGATTGATGCTTTAAATGCAGAAGTGGAAAATTTAAAGGTACCGACACTGAACTCGTAGAATTAACTCTAAGTGCTCCCAACCTGATGT
TCCCCCATTAAAGAACAAAGGAAAGAAAAATACAGAATTTGTGTGTAAGTTCCATCTTTTTTCCACTAACATATGGTTGATAGTTTCATGCTGATACCTT
TATATAGGTGTTATTGCAATCTGAAAAGCAACGTGCTGATGAGATAGAAAAGAAACGTGCTGACTCGCAAGAATCAAGTGAAGAAAAGCACAAGAAGTTG
GAAGAAACTGAAAAAAAAGTTCAACAATATCAGGAATCAATGAGCAGGTAGCTA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.948378
Expected error %
0.126647
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g54560.1 Score 94 E Value 1e-19 Identity 20.90% Align. Length 224bp (29.71%) Frame 1
68414.m06222 myosin, putative similar to myosin GI:433663 from [Arabidopsis thaliana]
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g08730.1 Score 91 E Value 5e-19 Identity 18.80% Align. Length 233bp (30.90%) Frame 1
68414.m00969 myosin heavy chain (PCR43) identical to myosin heavy chain PCR43 (PIR:T00727) [Arabidopsis thaliana]; similar to ESTs gb|R30087 and gb|AA394762
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT85070.1| Score 99 E Value 9e-20 Identity 21.30% Align. Length 224bp (29.71%) Frame 1
myosin heavy chain class XI E3 protein, putative [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD17931.2| Score 97 E Value 4e-19 Identity 20.90% Align. Length 224bp (29.71%) Frame 1
unconventional myosin heavy chain [Zea mays] pir||A59310 unconventional myosin heavy chain - maize
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0005F12
Clone
Clone name
hba-5f12
LE_HBa0005F12
P005F12
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found