Clone Read LE_HBa0005F12_T7_1799

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0005F12_T7_1799
Primer
T7
ID from Seq. Facility
LE_HBa_005_F12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
676 trimmed for vector and quality, 925 raw
Genbank Accession
Sequence
>LE_HBa0005F12_T7_1799 (raw untrimmed)
GGGGGGCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGTGTTTTCCTCTTCTCGTTCGATCCTCTCTCTCTTTTTGTTCTTTCTATTTT
CTTTATTCAAACCCTCTTTCTTTTACCCTAATTAGCATATAATTAAGAATAAAAGATGGCAATAATAACCCACTAATTTACTCAAGGTTACCTTTTTTAA
CCCCCAAGTAATTAGACTTATTAACATTAACCCACTAACTTTATAATTAAAGCAGGAATAGTAAAAAACGTCCCTTAAAACATTAAAGAAATCCGACTCA
GCCTGGGATTATGCAGCCTGTGACGACTCGTCGTGCCTGCGACGGTCCGTCTTGCTGCTCCGTCACAGAGTTCAGAGACTCAATTTCCCTTAAAGAGTCT
GTGACGGTCCGTCACGCCTGTGACGGTCCGTCCTGCCATTCCGTTACAAAGTTCAGAGAGTCGATTTCAGTACCCATTTTTCAGAATTTCTAAGTGTTTT
GAAACGAGACCCCTCGACGGTCCGTCGTGCCCATGACGGTCCGTCGTGGGATCCGTCGTCTCAACCATTTTTCCAGAAATAACATTTGTTGCTCAAAATG
ACTAAACAGGTCGTTACACTAACACTGATAAATGTTCTTCTCTATAATGTCTATATAGTTGAGATTTTGAATTTGTATTGTATAAAACTTTGATATTCAA
TAAATTTTTATTGATTTTGTTGAAAGATTTGATATCCTTTTCTGTATCTATTATTTCTCCTAATTGTTGATTATTCTCTTCCCTTTGCCCTTTTAATTTA
ATATTTTTGATAAAAAAGTTATTAACTTACAATATTTTTGGGAATAGCCTTGGGCCTTGGATTTTTTCTTCTCCTTGATCTAAGTTAAAAAAAAAATATC
CCATTTTTTTTCTTGTTTTTTTTAA
>LE_HBa0005F12_T7_1799 (trimmed for quality and cloning vector)
CTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGTGTTTTCCTCTTCTCGTTCGATCCTCTCTCTCTTTTTGTTCTTTCTATTTTCTTTATTCAAACCCTC
TTTCTTTTACCCTAATTAGCATATAATTAAGAATAAAAGATGGCAATAATAACCCACTAATTTACTCAAGGTTACCTTTTTTAACCCCCAAGTAATTAGA
CTTATTAACATTAACCCACTAACTTTATAATTAAAGCAGGAATAGTAAAAAACGTCCCTTAAAACATTAAAGAAATCCGACTCAGCCTGGGATTATGCAG
CCTGTGACGACTCGTCGTGCCTGCGACGGTCCGTCTTGCTGCTCCGTCACAGAGTTCAGAGACTCAATTTCCCTTAAAGAGTCTGTGACGGTCCGTCACG
CCTGTGACGGTCCGTCCTGCCATTCCGTTACAAAGTTCAGAGAGTCGATTTCAGTACCCATTTTTCAGAATTTCTAAGTGTTTTGAAACGAGACCCCTCG
ACGGTCCGTCGTGCCCATGACGGTCCGTCGTGGGATCCGTCGTCTCAACCATTTTTCCAGAAATAACATTTGTTGCTCAAAATGACTAAACAGGTCGTTA
CACTAACACTGATAAATGTTCTTCTCTATAATGTCTATATAGTTGAGATTTTGAATTTGTATTGTATAAAACTTTG

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.964781
Expected error %
0.112239
Sequence Annotations 
Automatic Annotations
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|U02430.1:1751-1832 Score 64 E Value 2e-11 Identity 100.00% Align. Length 31bp (4.59%) Frame 2
Cloning vector pMAMneoBlue
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|U02437.1:4662-4674-49 Score 64 E Value 2e-11 Identity 100.00% Align. Length 31bp (4.59%) Frame 2
Cloning vector pT3/T7-LUC
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0005F12
Clone
Clone name
hba-5f12
LE_HBa0005F12
P005F12
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found