Clone Read LE_HBa0076P14_SP6_18026

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0076P14_SP6_18026
Primer
SP6
ID from Seq. Facility
LE_HBa_076_P14-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
692 trimmed for vector and quality, 812 raw
Genbank Accession
Sequence
>LE_HBa0076P14_SP6_18026 (raw untrimmed)
ATAGTTTGCACTGGATGATTTTACTTTATCTAATGATTCCCTCAGAAGATCAGTACCAAGGTCTAACCTCACATTCATCAAACCAACCAATGGGAGACCT
ACATCTCCTCCCATACGGTGCCTCAAATGGGGCCATATCAATACTTGAGTGATAGCTATTATTGTATGAAAACTCTGCTAAGGGTAAGAAGTTATCCCAA
TGACCACCAAATTCTATCACACATGCACAAAACATATCCTCCAACACCTGAATCGTTCGCTCAAATTGACCATCGGTCTGAGGGTGAAATGCAGTACTAA
GATCCAACCTAGTACCTAATTCAGCATGCAATGTTCTCCAAAATTTAGAAGTAAATTGCGTACCTCTGTCTGATATGATGGAAAGTGGAACTCCATGCAA
CCGAACAATTTCTGAGATATAGAGTTTGGCTAACTTCTCTGCATTGTAAGTCACCTTGACCGGAATGAAGTGAGCAGACTTAGTTAATCTGTCAACGATT
ACCCAAATAGAATTAAATTTACTCAATGTCTTTGGAAGACCAACCACAAAATCCATTGCAATTCTTTCCCATTTCCATTCAGGAATGGGCATTTTCTGAA
GTGTTCCTCCGGGCCTCTAGTGTTCATACTTTACCTGCCGACAATTCGGGCATTGGGCAACAAAATCAACAATGTCACCCTTCATTCTACTCCACCAAAA
ATGTTGCTTTAGGTCACGATACATCTTGGTTGCACCAGGATGTTTAGAATACCTTGAACTATGAGCCTCTGTAAGAATATTGTGAATCAATTTATCAACA
CGGGGCACACAT
>LE_HBa0076P14_SP6_18026 (trimmed for quality and cloning vector)
ATTTTACTTTATCTAATGATTCCCTCAGAAGATCAGTACCAAGGTCTAACCTCACATTCATCAAACCAACCAATGGGAGACCTACATCTCCTCCCATACG
GTGCCTCAAATGGGGCCATATCAATACTTGAGTGATAGCTATTATTGTATGAAAACTCTGCTAAGGGTAAGAAGTTATCCCAATGACCACCAAATTCTAT
CACACATGCACAAAACATATCCTCCAACACCTGAATCGTTCGCTCAAATTGACCATCGGTCTGAGGGTGAAATGCAGTACTAAGATCCAACCTAGTACCT
AATTCAGCATGCAATGTTCTCCAAAATTTAGAAGTAAATTGCGTACCTCTGTCTGATATGATGGAAAGTGGAACTCCATGCAACCGAACAATTTCTGAGA
TATAGAGTTTGGCTAACTTCTCTGCATTGTAAGTCACCTTGACCGGAATGAAGTGAGCAGACTTAGTTAATCTGTCAACGATTACCCAAATAGAATTAAA
TTTACTCAATGTCTTTGGAAGACCAACCACAAAATCCATTGCAATTCTTTCCCATTTCCATTCAGGAATGGGCATTTTCTGAAGTGTTCCTCCGGGCCTC
TAGTGTTCATACTTTACCTGCCGACAATTCGGGCATTGGGCAACAAAATCAACAATGTCACCCTTCATTCTACTCCACCAAAAATGTTGCTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.967964
Expected error %
0.263865
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 350 E Value 1e-95 Identity 24.30% Align. Length 650bp (93.93%) Frame 1
putative polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 347 E Value 2e-94 Identity 24.10% Align. Length 650bp (93.93%) Frame 1
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0076P14
Clone
Clone name
hba-76p14
LE_HBa0076P14
P076P14
Clone type
BAC
Contamination
none
Estimated length
84,548
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found