Clone Read LE_HBa0077C12_SP6_18166

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0077C12_SP6_18166
Primer
SP6
ID from Seq. Facility
LE_HBa_077_C12-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
667 trimmed for vector and quality, 968 raw
Genbank Accession
Sequence
>LE_HBa0077C12_SP6_18166 (raw untrimmed)
AAAAAAAAAAGTTTTTCNTTTCCTAGTTGACTTCAGTTGACGAAAGCTGTCAGTTTTAGCAGAAAGTAATGAAAGAGCAACAGAATCGAGGATTGGTGGT
GGTGCATTGGAGGGCCTTCCACCAAGGCGCAGGGATGGCCAGGATTATGCTGCTGCAGCTGGTGGTAGATGGCAGGACTTCTCCTTCTCACAAGGCAGGC
AAGGTAGTAGTGGTGGCCGAACAGGGTATGCCGGTAGTAGATCAACTTCTGGTCAAACATCGAGGGACCGTACTAATCAGGCACGAGGGACTCTTGGGGG
TCAAGGCTCAAGATATCAGAGTGGTACAACTTCCAGGGGAAGCCAGATGGATGGTTCAGGTCGCATGGTTAATCTTAACAGAGGGGGTCGTTCTTAGAGA
GAGACGTGCACAATTTTTGCATAGGAAGAATCACATATCTTGAGGGTTCCTTGTTGTAGTAGAGTTTACAGTTTTCTTTGTTTCATAGACCAAGTTCCAT
TGTGCTACATTGTTTTGTGACTTTGTAGAGCATCTTTTGGATGTTGCACTGCTTTTCTCATTTAATGACACAACAATTCCTTTTAAATGTAATTTGCATC
AAATATTAGCTCGTAATACATACACACTAGAGTATTGTCTTTGCTAGATGTTGCTGCACAAATCTCGTAACAGATACACATTACAGTCTGCTAATACCAA
TATGCTCACTGAGTTGATTTTTTACCCCCCAGCCATAACTATAAATAGATTGGAATTGATAAAGTAACCGTATTTATAGAGATCTTTGAATAAACAACAA
AAATTTTACCACCTGCTAACTATTACTTTCTTCCTCCCACCAAATGTTATTCAGTACCGTATAACCCGAAAAAATTTGAAATTTAAAAATTCCATTTTTG
TTGCCTTGTTTGGTTTTTAATTCAAAAACCGACACTAAAGAATTTAATTTGATATTTAAAAACCCAAA
>LE_HBa0077C12_SP6_18166 (trimmed for quality and cloning vector)
AGCTGTCAGTTTTAGCAGAAAGTAATGAAAGAGCAACAGAATCGAGGATTGGTGGTGGTGCATTGGAGGGCCTTCCACCAAGGCGCAGGGATGGCCAGGA
TTATGCTGCTGCAGCTGGTGGTAGATGGCAGGACTTCTCCTTCTCACAAGGCAGGCAAGGTAGTAGTGGTGGCCGAACAGGGTATGCCGGTAGTAGATCA
ACTTCTGGTCAAACATCGAGGGACCGTACTAATCAGGCACGAGGGACTCTTGGGGGTCAAGGCTCAAGATATCAGAGTGGTACAACTTCCAGGGGAAGCC
AGATGGATGGTTCAGGTCGCATGGTTAATCTTAACAGAGGGGGTCGTTCTTAGAGAGAGACGTGCACAATTTTTGCATAGGAAGAATCACATATCTTGAG
GGTTCCTTGTTGTAGTAGAGTTTACAGTTTTCTTTGTTTCATAGACCAAGTTCCATTGTGCTACATTGTTTTGTGACTTTGTAGAGCATCTTTTGGATGT
TGCACTGCTTTTCTCATTTAATGACACAACAATTCCTTTTAAATGTAATTTGCATCAAATATTAGCTCGTAATACATACACACTAGAGTATTGTCTTTGC
TAGATGTTGCTGCACAAATCTCGTAACAGATACACATTACAGTCTGCTAATACCAATATGCTCACTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.969698
Expected error %
0.104268
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g56150.1 Score 87 E Value 8e-18 Identity 17.50% Align. Length 347bp (52.02%) Frame 1
68416.m06241 eukaryotic translation initiation factor 3 subunit 8 / eIF3 p110 / eIF3c / p105 (TIF3C1) nearly identical to SP|O49160 Eukaryotic translation initiation factor 3 subunit 8 (eIF3 p110) (eIF3c) (p105) {Arabidopsis thaliana}
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAL13083.1| Score 91 E Value 2e-17 Identity 19.50% Align. Length 347bp (52.02%) Frame 1
putative translation-initiation factor 3 subunit [Prunus avium]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD39891.1| Score 91 E Value 2e-17 Identity 18.40% Align. Length 347bp (52.02%) Frame 1
putative translation initiation protein [Medicago truncatula] sp|Q9XHM1|IF38_MEDTR Eukaryotic translation initiation factor 3 subunit 8 (eIF3 p110) (eIF3c) pir||T50774 probable translation initiation factor [imported] - barrel medic
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0077C12
Clone
Clone name
hba-77c12
LE_HBa0077C12
P077C12
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found