Clone Read LE_HBa0077C12_T7_18167

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0077C12_T7_18167
Primer
T7
ID from Seq. Facility
LE_HBa_077_C12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
753 trimmed for vector and quality, 954 raw
Genbank Accession
Sequence
>LE_HBa0077C12_T7_18167 (raw untrimmed)
TTAAACCTGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCCACTACTTGGTGGAGTCCTAGACCATCTGGATCACGTTGGATCTAT
TGTACACAGCCTAGACCCCTTTGCGGTTTAAGTATAGTTTATCTCAAAATGTACGGTCTGTTGTGAAATTAAATTTTCAGAAGCATCTAGAGCTTTGATC
TAGTAATAGAAGTGCAGCTCGTGATGTGTAGGTTAGGTGTACGCCATGGGTTTGCCGCAAACATAAGCCTAGTTGTAAGTGGAAAAAGGGTAGTGGGACT
GGCCTTATCTACTGAGTTTAGAACCAGACAGTTCTAGCCCTCGAGGATTTCTTTTGTTATTAAAAGAAAAAGTTACTTTCCAAAGAAAGAATCAAGAGAA
AAATATGCCTACTTATTGACTTACTTGAGAACACTCCCTCCTCTCTATCTCTTCTGTCTCCATCTCACCTTTCCTTTTGGTTGTGGTTGGAGAGTGGGTG
GACTTGACCGCAATGTTTTTGGTAAATTATGTGGGCAGTTTAATTAATCATATGTTGCTCGGAGTATTTTCATTGCTGATCCTATTGTAGATATCAAATA
CCTGATGATTGGCCTTATGAAGAGGCTAGGCGGCTCTTCAAGGAACCATTAGTTGTTACAGATGATGAGCAAACTGAACTAAAATGGGCTGCTCCTGATG
AAGAAGTGATTGTCTTACCTGAGAAACTTTTGATTTTTTGGTGGGTTGTAAATGAATTTTAACAGAATCTTCATTTTTATATTCTATTCTTATTAGGGGT
TGGTTAACCTTTCGGGAAAGGGAAAATGAATTCAACTTGGATAGAGTTCCAAAGGGTTCATTCCTTTTGCCATTTTTGGAAGAAATTTCTTCCAGATTTT
TTGATGGATAGAATTATTTCTTTTGATCTTGCTTTGTTCAGGAAAAAAAAATAT
>LE_HBa0077C12_T7_18167 (trimmed for quality and cloning vector)
AGCTTCCACTACTTGGTGGAGTCCTAGACCATCTGGATCACGTTGGATCTATTGTACACAGCCTAGACCCCTTTGCGGTTTAAGTATAGTTTATCTCAAA
ATGTACGGTCTGTTGTGAAATTAAATTTTCAGAAGCATCTAGAGCTTTGATCTAGTAATAGAAGTGCAGCTCGTGATGTGTAGGTTAGGTGTACGCCATG
GGTTTGCCGCAAACATAAGCCTAGTTGTAAGTGGAAAAAGGGTAGTGGGACTGGCCTTATCTACTGAGTTTAGAACCAGACAGTTCTAGCCCTCGAGGAT
TTCTTTTGTTATTAAAAGAAAAAGTTACTTTCCAAAGAAAGAATCAAGAGAAAAATATGCCTACTTATTGACTTACTTGAGAACACTCCCTCCTCTCTAT
CTCTTCTGTCTCCATCTCACCTTTCCTTTTGGTTGTGGTTGGAGAGTGGGTGGACTTGACCGCAATGTTTTTGGTAAATTATGTGGGCAGTTTAATTAAT
CATATGTTGCTCGGAGTATTTTCATTGCTGATCCTATTGTAGATATCAAATACCTGATGATTGGCCTTATGAAGAGGCTAGGCGGCTCTTCAAGGAACCA
TTAGTTGTTACAGATGATGAGCAAACTGAACTAAAATGGGCTGCTCCTGATGAAGAAGTGATTGTCTTACCTGAGAAACTTTTGATTTTTTGGTGGGTTG
TAAATGAATTTTAACAGAATCTTCATTTTTATATTCTATTCTTATTAGGGGTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.965146
Expected error %
0.797627
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g26680.1 Score 72 E Value 4e-13 Identity 23.00% Align. Length 125bp (16.60%) Frame 2
68418.m03171 endonuclease, putative similar to Swiss-Prot:P39748 FLAP endonuclease-1 (Maturation factor 1) (MF1) [Homo sapiens]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_850877.2| Score 72 E Value 2e-11 Identity 23.00% Align. Length 125bp (16.60%) Frame 2
endonuclease, putative [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC13596.1| Score 72 E Value 2e-11 Identity 23.00% Align. Length 125bp (16.60%) Frame 2
similar to FLAP endonuclease-1 (SW:P39748) [Arabidopsis thaliana] pir||T01198 endonuclease homolog F21E10.3 - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0077C12
Clone
Clone name
hba-77c12
LE_HBa0077C12
P077C12
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found