Clone Read LE_HBa0077I15_SP6_18460

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0077I15_SP6_18460
Primer
SP6
ID from Seq. Facility
LE_HBa_077_I15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
675 trimmed for vector and quality, 966 raw
Genbank Accession
Sequence
>LE_HBa0077I15_SP6_18460 (raw untrimmed)
CTGTATGGCTTAATGTGATGGGCGTCATTGAAGGTGCACGAGACGGATTTATCCTGCTCGTGATTTGGAGTTGGCACCAGTGATATTTACTCATAAAATC
TGGTGACAATATTTGTATGGAGTTAAGTATGAGGTATTTACTGATCATCGTAGTTTATAGTATGTATTAACCCAAAAGGATTTGAATCTGAGAAAGCAAA
GATGGATGGAATTACTCAAGGATTATGATGTTACTATTCAATACCATTCGGGTAAGGAAAATATTATGGCAGATGTTTGAGTCAAAAAGCGATAAGTATG
GGTAGTTTAGCTCATTTGTATGGAACCAAGCGAATATTGGCCATGGAGATTCAAACCTTGGAGTCTTAGTTTGTGCATTTGGGCATCTCTGAAAAAGGTG
GGTAGATAGCATTGAAGCTAACTCCATGTTAATAAAGGAATTCTAGGCCAAAAATTTTTTATGTAGATTTAGATGAACTTAGAACAAAGATTTCAATAGG
TATGTCTCAAGGTACCATCCTAGATGTGTGTGGTGTGCTCAACTATAAGGGTAGAAAATTTGTTATGACAGCTGATGATTTGATTCCAAGATTGTTGGCG
AAGGCTCATTGTTCGTGCTATTCTATTAATCCAGGCGTGACAAAGATGTATAAAGATCTGAAATGGGTGTATTGGTGGTCGGGTATGAGAAAAGACATTG
AAAAGTTGTGGGCAAATTGTAAGAATTGTCAACAAGTGGAGTATGAACATCAAAGGCATGCGGGGACTACTTTCAAAGGATTCCAATTCCTAAAGGGAAG
TGGGAAAAGATAGCAAGGATTTTTGGGATGGGCTTCCCAGACTTCAGGTAATCTGACTTTTTTTGGGTAAGGATAAAATGGTTTATGATATATCCTCTCT
AAATACGAATAGGTAGGTCAAGCATATTAACACCTGATATAAGGACTCACTACTAAAAAATATCTA
>LE_HBa0077I15_SP6_18460 (trimmed for quality and cloning vector)
TTGAAGGTGCACGAGACGGATTTATCCTGCTCGTGATTTGGAGTTGGCACCAGTGATATTTACTCATAAAATCTGGTGACAATATTTGTATGGAGTTAAG
TATGAGGTATTTACTGATCATCGTAGTTTATAGTATGTATTAACCCAAAAGGATTTGAATCTGAGAAAGCAAAGATGGATGGAATTACTCAAGGATTATG
ATGTTACTATTCAATACCATTCGGGTAAGGAAAATATTATGGCAGATGTTTGAGTCAAAAAGCGATAAGTATGGGTAGTTTAGCTCATTTGTATGGAACC
AAGCGAATATTGGCCATGGAGATTCAAACCTTGGAGTCTTAGTTTGTGCATTTGGGCATCTCTGAAAAAGGTGGGTAGATAGCATTGAAGCTAACTCCAT
GTTAATAAAGGAATTCTAGGCCAAAAATTTTTTATGTAGATTTAGATGAACTTAGAACAAAGATTTCAATAGGTATGTCTCAAGGTACCATCCTAGATGT
GTGTGGTGTGCTCAACTATAAGGGTAGAAAATTTGTTATGACAGCTGATGATTTGATTCCAAGATTGTTGGCGAAGGCTCATTGTTCGTGCTATTCTATT
AATCCAGGCGTGACAAAGATGTATAAAGATCTGAAATGGGTGTATTGGTGGTCGGGTATGAGAAAAGACATTGAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.956694
Expected error %
0.0699782
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV31171.1| Score 112 E Value 7e-41 Identity 37.10% Align. Length 649bp (96.15%) Frame 3
putative polyprotein [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 110 E Value 3e-43 Identity 43.30% Align. Length 655bp (97.04%) Frame 3
putative polyprotein, 3'-partial [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0077I15
Clone
Clone name
hba-77i15
LE_HBa0077I15
P077I15
Clone type
BAC
Contamination
none
Estimated length
108,946
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found