Clone Read LE_HBa0077J17_SP6_18512

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0077J17_SP6_18512
Primer
SP6
ID from Seq. Facility
LE_HBa_077_J17-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
681 trimmed for vector and quality, 966 raw
Genbank Accession
Sequence
>LE_HBa0077J17_SP6_18512 (raw untrimmed)
GGGCCTTAAGATGTACGTAAAATATATATATATAAGATGTTCGAGTACGGCACAAAATAAATACTGTTTAATTTGCCTGTGTAGTGACTGAAATAGTAAA
AACCAGATGAAAGCAACAACAACAACATATAATTAACTAGCCAAGATTATTTCACCTTTTCAACATAATTTCTCATGGCTGGAGGACAAAGTCCAAGAAA
TCTCAACAAACCATGTATTCTCCTCATAGGTAACTTTCATTTCATTTTTTCAGGTACGTAGGATTATACTGAATATATTGTTACTTAAATTTTGTGGTTT
TAATTTGGCAGTAATAGCGGGAATGGAGAGGTTTTCATTCAAAGGGGTGGCATCAAATTTAGTGACATATCTAACAGACGTGGCCAAAATGAGCAATTCA
GCTGCAGCAAAGATGGTTAACAATTGGTGTGGTATTACTTCTATGTTGCCATTGCTGGTTGCTCCACTAGCTGATTCTTATTTGGACCGCTACACCACTG
TATTGGCTTCTTCTTCTCTATATTTTGCCGTAAGTTCCCTTTCAATTCGTCTCTAAAAAATCATAAGGTCTTATTGTGCGCAGTTTTACTCAGCATTTAC
CATAGAATTTCAACTGAATCTCCTTTATTAGAAAATTATCTAGTGTTAGGCAAAACTTTTTAATTGATGAATACAAATTGTTGAATCCATCTGAGTTTAA
CATTATATAAGCTTCTAGTGAAGTCTAGCTGCAAATATTATGCTTAGGCTAAAAGTTTGAATGGTAAATGTGACACATTTTACCTTTTCCTTCGAATTTA
GTTATTAGAATTTTTTATATTTTCCTTTTCTTATGTCAGTTAAAAATATTTCAAAACATCTCCCAAATAGGAAAAATTTTGAACCCCGTACAAGGTTGGA
TTGGGCTTTCAAAAAAGTTATTATTTCGCCCTTCGTTCGGCGTGTGAATTTGAGCGAAAGTAGAGA
>LE_HBa0077J17_SP6_18512 (trimmed for quality and cloning vector)
ATATATATATATAAGATGTTCGAGTACGGCACAAAATAAATACTGTTTAATTTGCCTGTGTAGTGACTGAAATAGTAAAAACCAGATGAAAGCAACAACA
ACAACATATAATTAACTAGCCAAGATTATTTCACCTTTTCAACATAATTTCTCATGGCTGGAGGACAAAGTCCAAGAAATCTCAACAAACCATGTATTCT
CCTCATAGGTAACTTTCATTTCATTTTTTCAGGTACGTAGGATTATACTGAATATATTGTTACTTAAATTTTGTGGTTTTAATTTGGCAGTAATAGCGGG
AATGGAGAGGTTTTCATTCAAAGGGGTGGCATCAAATTTAGTGACATATCTAACAGACGTGGCCAAAATGAGCAATTCAGCTGCAGCAAAGATGGTTAAC
AATTGGTGTGGTATTACTTCTATGTTGCCATTGCTGGTTGCTCCACTAGCTGATTCTTATTTGGACCGCTACACCACTGTATTGGCTTCTTCTTCTCTAT
ATTTTGCCGTAAGTTCCCTTTCAATTCGTCTCTAAAAAATCATAAGGTCTTATTGTGCGCAGTTTTACTCAGCATTTACCATAGAATTTCAACTGAATCT
CCTTTATTAGAAAATTATCTAGTGTTAGGCAAAACTTTTTAATTGATGAATACAAATTGTTGAATCCATCTGAGTTTAACA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.953468
Expected error %
0.0600808
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g01350.1 Score 102 E Value 3e-22 Identity 24.20% Align. Length 218bp (32.01%) Frame 3
68416.m00055 proton-dependent oligopeptide transport (POT) family protein contains Pfam profile: PF00854 POT family
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g14940.1 Score 95 E Value 3e-20 Identity 22.80% Align. Length 218bp (32.01%) Frame 3
68418.m01753 proton-dependent oligopeptide transport (POT) family protein contains Pfam profile: PF00854 POT family
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAF03501.1| Score 102 E Value 1e-20 Identity 24.20% Align. Length 218bp (32.01%) Frame 3
putative peptide transporter [Arabidopsis thaliana] ref|NP_186784.1| proton-dependent oligopeptide transport (POT) family protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAC01813.1| Score 95 E Value 1e-18 Identity 22.80% Align. Length 218bp (32.01%) Frame 3
oligopeptide transporter-like protein [Arabidopsis thaliana] ref|NP_196998.1| proton-dependent oligopeptide transport (POT) family protein [Arabidopsis thaliana] pir||T51439 oligopeptide transporter-like protein - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0077J17
Clone
Clone name
hba-77j17
LE_HBa0077J17
P077J17
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found