Clone Read LE_HBa0077J17_T7_18513

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0077J17_T7_18513
Primer
T7
ID from Seq. Facility
LE_HBa_077_J17-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
701 trimmed for vector and quality, 950 raw
Genbank Accession
Sequence
>LE_HBa0077J17_T7_18513 (raw untrimmed)
CTAGCCGTGGTCCGGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATTCAAGAAAGATTATTAGCAGCCCAGAATCGACAGAAGTCATATGCA
GATAATCGGCGTCGAGATTTGGAGTTTTAGATTGGTGACTGGGTATTCCTGAAGGTATCACCCATGAGGGGTGTGATGAGATTCGGCAGGAAGGGGAAGC
TCAGTCCGAGATACATTGGGCCTTATCAGATTGTTCGTAGGATAGGCAAGGTTGCCTATGAGTTGGATCAACCATCTGATTTGGAGGCGGTACATCTAGT
CTTCCATGTATCGATGCTATGTAAATGTATTGGTGATCCTTCTAGAGTATTCCACGTAGATGATGTTCAGGTAACAGAGGAGTTGTCATATAAGGAGAAA
CCCATAGCTACACTTGATCGTCAGGTTAGAAGGTTACATACTAAGGATGTGGCTTCCGTCAAAGTGTTGTGGCAAAATAACAATAGGGAGGAGATGACTT
GGGAAGCGGAAGATGAAATGAAGAATAAATATCCTTACATGTTCCCCGTACCTGCAGGTAATTCAATTCCTAGCTTGACTATATTGATTGATAAGCGAGA
TTATGTAGTAAGTTGTGACTCTGTGAGGCATCTGTAAGTCACGAAATGCAGGTTGATAGGTATAACTGTTAGAGAGACCTCCCTGGAATTTGTTTTTGTA
AGACGCTAACTTAACATTTCGAGGAAGAATTTTCCTAAGGGGGGAAGAATGTTTTGCCTCCTTATTTTTTTTAAACGTAGTGCCCATCCTTAATCAGATA
ACCTAAGTCCAGGGTATTGAGATTTTATTTTAACTTCCAATCATTAAAAAATTATTGATCCAAGTACTACCTTCCACAAGGCGTATTTAAAAAGAAATCA
CCACATATAGCCTATTCACCGAAGAACGAATATTTTTCAGCTTTATTTCA
>LE_HBa0077J17_T7_18513 (trimmed for quality and cloning vector)
AGCTTATTCAAGAAAGATTATTAGCAGCCCAGAATCGACAGAAGTCATATGCAGATAATCGGCGTCGAGATTTGGAGTTTTAGATTGGTGACTGGGTATT
CCTGAAGGTATCACCCATGAGGGGTGTGATGAGATTCGGCAGGAAGGGGAAGCTCAGTCCGAGATACATTGGGCCTTATCAGATTGTTCGTAGGATAGGC
AAGGTTGCCTATGAGTTGGATCAACCATCTGATTTGGAGGCGGTACATCTAGTCTTCCATGTATCGATGCTATGTAAATGTATTGGTGATCCTTCTAGAG
TATTCCACGTAGATGATGTTCAGGTAACAGAGGAGTTGTCATATAAGGAGAAACCCATAGCTACACTTGATCGTCAGGTTAGAAGGTTACATACTAAGGA
TGTGGCTTCCGTCAAAGTGTTGTGGCAAAATAACAATAGGGAGGAGATGACTTGGGAAGCGGAAGATGAAATGAAGAATAAATATCCTTACATGTTCCCC
GTACCTGCAGGTAATTCAATTCCTAGCTTGACTATATTGATTGATAAGCGAGATTATGTAGTAAGTTGTGACTCTGTGAGGCATCTGTAAGTCACGAAAT
GCAGGTTGATAGGTATAACTGTTAGAGAGACCTCCCTGGAATTTGTTTTTGTAAGACGCTAACTTAACATTTCGAGGAAGAATTTTCCTAAGGGGGGAAG
A

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.97319
Expected error %
0.608242
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38724.1| Score 235 E Value 9e-61 Identity 22.40% Align. Length 494bp (70.47%) Frame 1
putative retrotransposon protein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38792.1| Score 234 E Value 2e-60 Identity 22.20% Align. Length 494bp (70.47%) Frame 1
putative gag-pol polyprotein [Solanum demissum] gb|AAT38791.1| putative gag-pol polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0077J17
Clone
Clone name
hba-77j17
LE_HBa0077J17
P077J17
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found