Clone Read LE_HBa0077L14_SP6_18602

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0077L14_SP6_18602
Primer
SP6
ID from Seq. Facility
LE_HBa_077_L14-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
736 trimmed for vector and quality, 923 raw
Genbank Accession
Sequence
>LE_HBa0077L14_SP6_18602 (raw untrimmed)
AAAAAAAAATGGTTTTCTTTTTCCGAGTGACATTAAGTTTGCTTGACTTCTTCCTCATGTTCGGGAGCCCAGACATAATATTTCTGAAATAAAAAATGAC
TAAATATTTATTTCTCAAATAAATAGCGAATTTAAATGTATATGACGTGAATTTAATTGATACACATTCTTACCTTAAATTCATTGAACATCTGTCCCCT
ATTGCTAATTGGAATCGACCCCAAGTTGGGTACACACCATTATAGTGAGTATCGATGAACTTTAAAATAATCTTTGACATACCCACATCCGGACAGAAGC
TGAAATGTGATTTATTGACAAAGAATGGTAAACAAAAAATAATCAATCAATTTATAAAAGTATAAAAAGACAAATAAAAAATGAAACATAATTAAATCAT
ACTTGCATCCTAACGGCTCGATGACAAGTCTCAGAAAATTATTTTTATCACCTAGCTGAGGACCACGTGCATCTGAGTGCTGGGTGACGGGAGTATTAGA
CTCCGAGCCATTGGATTCAAGATGAAGATTTGACAATTCAATTGATCCACTATTAGTATTCAAATTATTGCACTGACTAGCACTAGCTGATGGTATGGTA
GACTCACGACCAATATGTGAATAACCCTGCAATGTTTGGTAACCTGATCTACATACCACAGTGGGTGTAGATATAGTATAACCAGATTGTGGAGCCACAT
GAGTAGAGGCATTATGTGTCTGGATTGCAAAGTGAGTAGGTAAAACTGAGGGTCGTTTTGAATATTCACTCTAGAGGGCTCATCAGATATCACCACCTAG
TGAACCTTCTCAAAGCATTGGCCTTGAATTCCTTTTTTGGATTAGCTGACATTTTTTATTTACCCTTGTCTTTATCTACCATCCTTATCAATAAACCACA
AAATTAAAAAAGAATAGTACAAA
>LE_HBa0077L14_SP6_18602 (trimmed for quality and cloning vector)
AAGTTTGCTTGACTTCTTCCTCATGTTCGGGAGCCCAGACATAATATTTCTGAAATAAAAAATGACTAAATATTTATTTCTCAAATAAATAGCGAATTTA
AATGTATATGACGTGAATTTAATTGATACACATTCTTACCTTAAATTCATTGAACATCTGTCCCCTATTGCTAATTGGAATCGACCCCAAGTTGGGTACA
CACCATTATAGTGAGTATCGATGAACTTTAAAATAATCTTTGACATACCCACATCCGGACAGAAGCTGAAATGTGATTTATTGACAAAGAATGGTAAACA
AAAAATAATCAATCAATTTATAAAAGTATAAAAAGACAAATAAAAAATGAAACATAATTAAATCATACTTGCATCCTAACGGCTCGATGACAAGTCTCAG
AAAATTATTTTTATCACCTAGCTGAGGACCACGTGCATCTGAGTGCTGGGTGACGGGAGTATTAGACTCCGAGCCATTGGATTCAAGATGAAGATTTGAC
AATTCAATTGATCCACTATTAGTATTCAAATTATTGCACTGACTAGCACTAGCTGATGGTATGGTAGACTCACGACCAATATGTGAATAACCCTGCAATG
TTTGGTAACCTGATCTACATACCACAGTGGGTGTAGATATAGTATAACCAGATTGTGGAGCCACATGAGTAGAGGCATTATGTGTCTGGATTGCAAAGTG
AGTAGGTAAAACTGAGGGTCGTTTTGAATATTCACT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.958371
Expected error %
0.0969195
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0077L14
Clone
Clone name
hba-77l14
LE_HBa0077L14
C02HBa0077L14
P077L14
Clone type
BAC
Contamination
none
Estimated length
34,413
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found