Clone Read LE_HBa0077N02_T7_18675

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0077N02_T7_18675
Primer
T7
ID from Seq. Facility
LE_HBa_077_N02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
708 trimmed for vector and quality, 888 raw
Genbank Accession
Sequence
>LE_HBa0077N02_T7_18675 (raw untrimmed)
GGGGGAGGGGGGGTCGGGGGGGATCTCTAGAGTCGACGTGCAGGCATGCAAGCTTTGAATTCATTGTTCTTAAATTGCATATAGGTCTTGGCAAATAAGC
TAATAAAGCTTGGTGCAGTGACAATATACAATCAACAAAGAATAGAAAGGAGAGAAAAAGCACTATCCAATCCCAAATATATATAATCCACATAGTGTTA
CACTATACCCATGCACATAAAGTTTATTCAACTTACAAATGCAATATGCACTATAGAGTATAATAGTAAAATGAAAAGTGCAAAACTGAGGATTTGCTTC
TAGAAACTTTACCCACATGAAGGCATGAATGAATATAATGGATATAATGCACTTTTAACTTTTGAAACACTTGAACATTGACAATCAAAAATAATAAACG
AGAGTATTTTTTAGTGCAAGTGTATTTATTATTTATATATCGGTGAAATATTGAGAACGTTATATTAATTAAATATTAATAGTTATAATAATATAATGAT
CGAAATTTACAAATATGTATTCACACACATATTTAAGTAAGTCATTTCGGATTTTTTTTGATAAGATCAAAAGACATATATACATACTTCTTTTGGGGGG
GAAGTGCACATATACTCGATTTTAAGTCGCTACTAAAATCACATTTTAAATTTATAGACTTTTTACATATACATCATTTCCTAATATACATATATAGGAT
TTGAAGTTTCGTGTTATAAAGTTCAAACATTTCTACTTTGAGTTTTTTTAACAAAACTTTTCTTTTTTGAATATTTAGTTGAAATTAGTTTTTTTTTCCG
GGTAAAAAAAAGCCTAATCATGGGGGTAATTTAATAATTTAGAAAAAAAAAGAAATAAGAACCTATATTATTTTGAAAAATGGAAAAT
>LE_HBa0077N02_T7_18675 (trimmed for quality and cloning vector)
TGCAAGCTTTGAATTCATTGTTCTTAAATTGCATATAGGTCTTGGCAAATAAGCTAATAAAGCTTGGTGCAGTGACAATATACAATCAACAAAGAATAGA
AAGGAGAGAAAAAGCACTATCCAATCCCAAATATATATAATCCACATAGTGTTACACTATACCCATGCACATAAAGTTTATTCAACTTACAAATGCAATA
TGCACTATAGAGTATAATAGTAAAATGAAAAGTGCAAAACTGAGGATTTGCTTCTAGAAACTTTACCCACATGAAGGCATGAATGAATATAATGGATATA
ATGCACTTTTAACTTTTGAAACACTTGAACATTGACAATCAAAAATAATAAACGAGAGTATTTTTTAGTGCAAGTGTATTTATTATTTATATATCGGTGA
AATATTGAGAACGTTATATTAATTAAATATTAATAGTTATAATAATATAATGATCGAAATTTACAAATATGTATTCACACACATATTTAAGTAAGTCATT
TCGGATTTTTTTTGATAAGATCAAAAGACATATATACATACTTCTTTTGGGGGGGAAGTGCACATATACTCGATTTTAAGTCGCTACTAAAATCACATTT
TAAATTTATAGACTTTTTACATATACATCATTTCCTAATATACATATATAGGATTTGAAGTTTCGTGTTATAAAGTTCAAACATTTCTACTTTGAGTTTT
TTTAACAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.914234
Expected error %
0.330439
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0077N02
Clone
Clone name
hba-77n2
LE_HBa0077N02
P077N02
Clone type
BAC
Contamination
none
Estimated length
84,154
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found