Clone Read LE_HBa0077O05_SP6_18728

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0077O05_SP6_18728
Primer
SP6
ID from Seq. Facility
LE_HBa_077_O05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
579 trimmed for vector and quality, 936 raw
Genbank Accession
Sequence
>LE_HBa0077O05_SP6_18728 (raw untrimmed)
AAAAAAAAAGGTTTTCCTTCAACTATGTAAACCCCCCNNTACCANTGTCTTCATTTGCATATGGATAACATCATGTATTCGACGGAATCCTTTAAAGCAA
AGAGGGTGGTGTGAGGGTGTTGGTCATGTCCACTTATGCGGGTCTCTGTTTTCACCTGATTTCACTATTGTTACTATCTATGATGCCTGTCTGTCTTGAA
GGTGTTTGGCTTTGTGCTGTCAAAAAGGTTAAAATGAGCATCTTGTTTGGTTGGTCCACTACTTCTTTAAGATATTCTGTTTAACAAGTATTACAGTCCT
GAGTTAAGTTCTGCTGTTAACAAAGATCACTCTTTCTTATTGTTGGTAAGATGCACCAAATCAGTAGAGTCATACAATTAGGACTGATCGAATTCTTGAT
GAACCATTAAGTAGGTTTTGTTTTGTCCTATCTATTTTCAGGTAGAACCAGAGAACCTGTTTTAGAGGTGGAAAGTGACACAATGTGATGAAATCATATT
AGTTTATCCTTCTGGAGTAACTCACCTTAGACCTTTTGCAACAGATAGAAAAATCTACTTGCACAATGAGAATAACTGCAAGTGCTATTAGCTAGAAGGG
TAATTAATTCTCATTCTGCTTTAATAGTAATCTTCTCATTGTACTTTATGGAAGTCTCTCATCTTCCCAGTTAAAAAAGAAGTGAAATATCATATCTATT
TTGCGGAGAAGAGAATACAACTACTACTTCTATGTCTCACACCCCAAAAAGTTAGAATTGGCTAAAACAATTCTTGTTGGCCAATTTTATCCATTCAAAA
GCCCCTACCTGAATATTCCACACATTAGAACTTTAACCCTATTATTTAACCCGCACTAAATTTTCTCATCCGCTTAACCAACTTAAAGACCACACCTAAT
CAAACTTGTTCAATGCCTTATAATTCTTCCCACTTT
>LE_HBa0077O05_SP6_18728 (trimmed for quality and cloning vector)
TGTCTTCATTTGCATATGGATAACATCATGTATTCGACGGAATCCTTTAAAGCAAAGAGGGTGGTGTGAGGGTGTTGGTCATGTCCACTTATGCGGGTCT
CTGTTTTCACCTGATTTCACTATTGTTACTATCTATGATGCCTGTCTGTCTTGAAGGTGTTTGGCTTTGTGCTGTCAAAAAGGTTAAAATGAGCATCTTG
TTTGGTTGGTCCACTACTTCTTTAAGATATTCTGTTTAACAAGTATTACAGTCCTGAGTTAAGTTCTGCTGTTAACAAAGATCACTCTTTCTTATTGTTG
GTAAGATGCACCAAATCAGTAGAGTCATACAATTAGGACTGATCGAATTCTTGATGAACCATTAAGTAGGTTTTGTTTTGTCCTATCTATTTTCAGGTAG
AACCAGAGAACCTGTTTTAGAGGTGGAAAGTGACACAATGTGATGAAATCATATTAGTTTATCCTTCTGGAGTAACTCACCTTAGACCTTTTGCAACAGA
TAGAAAAATCTACTTGCACAATGAGAATAACTGCAAGTGCTATTAGCTAGAAGGGTAATTAATTCTCATTCTGCTTTAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.954808
Expected error %
0.36661
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0077O05
Clone
Clone name
hba-77o5
LE_HBa0077O05
C04HBa0077O05
P077O05
Clone type
BAC
Contamination
none
Estimated length
118,522
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found