Clone Read LE_HBa0077O05_T7_18729

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0077O05_T7_18729
Primer
T7
ID from Seq. Facility
LE_HBa_077_O05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
646 trimmed for vector and quality, 909 raw
Genbank Accession
Sequence
>LE_HBa0077O05_T7_18729 (raw untrimmed)
GTTCAGCTGGGCCCGGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAGAAGCGAAAAAAATTATGGTGATAATTAGAGGAATGACAACCCT
TCGTGTTATTTTCCAAGGGCAGGGGTTTAATAACAGGAATGACCTAAAAAAATATCGGCCAAGTTTTTTTTTCGATGAGGATATTTTGAGAATTTTAATT
TTTAAGAGATTCCCAACATTATTTAAGTTGTTTGAATGAATTTTGTTAACTGAAAAAATTTATTACAATAGCTTCAAAATGATATTTCAATAGTGTTTTA
ATTGCTAATAGTTAATTTTAAAAATGGGTGCAAAGTAATTTACTTAATAATTTTTTTATTGTGTGGAGAGTAGAAAAGAGATTTCTATCTAAGAATTATG
GTATGTTAATAAATATTGTAATGATGGTGTTTTCGATGGTGATGTGAAATTGATGACTATCATGAATGATGCTCTACTAAGTTATAAGAACTAAGAAGAA
GAAAAGAGACGAAACAAAAACAAATAAAGAAAAAAAATAAAATGAAAAGAATATTAAAAATAAAGTTTTAACATTTATTTTTGATCTTCACTCTCATTGA
GAGAGTGAAATACATTCACTTTGCCCCATAAACGTTTTAGAGAGGTAATAATTTCAATTTTTAAATACTTTAAGAGGGTAATAAGAGTTCCGTGATGTAA
AAGTGTGTTTTTGAAACCGGGATATTAGGTTGGGGACTCCTTTTGTCCTTTAATTCAATTTAATTAACTTTTGTGATTTTTGAATCTTATTCTAGTTTTA
AATTCGAATTTAAAGTTGTGCTCCCGGAGGTCATATTAGCTCCTTTCTCCCCCCCCCTTGTAAGATATTTTCAAAGATACTTTGATGGTCTTTTCTTTCT
CCCTTTTAA
>LE_HBa0077O05_T7_18729 (trimmed for quality and cloning vector)
AGCTTGAGAAGCGAAAAAAATTATGGTGATAATTAGAGGAATGACAACCCTTCGTGTTATTTTCCAAGGGCAGGGGTTTAATAACAGGAATGACCTAAAA
AAATATCGGCCAAGTTTTTTTTTCGATGAGGATATTTTGAGAATTTTAATTTTTAAGAGATTCCCAACATTATTTAAGTTGTTTGAATGAATTTTGTTAA
CTGAAAAAATTTATTACAATAGCTTCAAAATGATATTTCAATAGTGTTTTAATTGCTAATAGTTAATTTTAAAAATGGGTGCAAAGTAATTTACTTAATA
ATTTTTTTATTGTGTGGAGAGTAGAAAAGAGATTTCTATCTAAGAATTATGGTATGTTAATAAATATTGTAATGATGGTGTTTTCGATGGTGATGTGAAA
TTGATGACTATCATGAATGATGCTCTACTAAGTTATAAGAACTAAGAAGAAGAAAAGAGACGAAACAAAAACAAATAAAGAAAAAAAATAAAATGAAAAG
AATATTAAAAATAAAGTTTTAACATTTATTTTTGATCTTCACTCTCATTGAGAGAGTGAAATACATTCACTTTGCCCCATAAACGTTTTAGAGAGGTAAT
AATTTCAATTTTTAAATACTTTAAGAGGGTAATAAGAGTTCCGTGA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.889589
Expected error %
0.737487
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0077O05
Clone
Clone name
hba-77o5
LE_HBa0077O05
C04HBa0077O05
P077O05
Clone type
BAC
Contamination
none
Estimated length
118,522
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found