Clone Read LE_HBa0005H23_T7_1917

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0005H23_T7_1917
Primer
T7
ID from Seq. Facility
LE_HBa_005_H23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
793 trimmed for vector and quality, 851 raw
Genbank Accession
Sequence
>LE_HBa0005H23_T7_1917 (raw untrimmed)
CTGGGATCCCGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAACGTGCTGAAGCCATCTATGCACATTTAAGGAGCACAAAACCTGATGCAC
TAAAACCCTCACATAAATCTGGTTTCCTTGGAATTATTGGTGAAAAGGTGGATTCAATTGAATTCTATAATGATAAGATTAAGGAGTTGATCGAAAAGTT
AGAAGCCGAACAAAAGGTGACTCTCAAAGAGAAACAACAATCATCTGCACTTGTCTTTTTCAACAGCAGGGTGGCTGCAGCTTCAGCATCACAGAATTTA
CATGCCCCAATAGTTGACACATGGACTGTTATAGATGCTCCAGAACCCCGACAGTTGATTTGGACTAATCTTTCAAAAAAGTTTTATGAGAGAATAATTC
GCCAGTATGTTGTGTACGCTGTTGTGTTTCTGACCATATTCTTTTACATAATTCCGATTGGGTTCATTTCTGCATTGACAACTTTAGACAATTTGGTGAA
GCTGTTCCCGTTTTTGAAACCGGTTGTTAAGCTGGAGGTCGTCAAGACAGTGCTAGAAGCGTATTTACCTCAACTTGCACTTATCTTATTTTTGGCTTTG
TTGCCAAAGTTTCTTCTGTTTCTATCCAAAGCAGAGGGCATCCCATCAGAAAGCCACGTGACAAGAGCTGCTTCAGGGAAATATTTTTATTTCACCGTGT
TGAATGTATTTATTGGTGTTACTCTGGGTGGAACTCTATTCACTTCCTTCAAGAGCATCGAGCATGATCCCAACTCTATTTTTCGTGTGTTGGCAAAAAA
GCCTTCCACAGAATGCAACTTTTTTTCTTGACTTTTTGTGGCTTTGAAGTT
>LE_HBa0005H23_T7_1917 (trimmed for quality and cloning vector)
AGCTTGAACGTGCTGAAGCCATCTATGCACATTTAAGGAGCACAAAACCTGATGCACTAAAACCCTCACATAAATCTGGTTTCCTTGGAATTATTGGTGA
AAAGGTGGATTCAATTGAATTCTATAATGATAAGATTAAGGAGTTGATCGAAAAGTTAGAAGCCGAACAAAAGGTGACTCTCAAAGAGAAACAACAATCA
TCTGCACTTGTCTTTTTCAACAGCAGGGTGGCTGCAGCTTCAGCATCACAGAATTTACATGCCCCAATAGTTGACACATGGACTGTTATAGATGCTCCAG
AACCCCGACAGTTGATTTGGACTAATCTTTCAAAAAAGTTTTATGAGAGAATAATTCGCCAGTATGTTGTGTACGCTGTTGTGTTTCTGACCATATTCTT
TTACATAATTCCGATTGGGTTCATTTCTGCATTGACAACTTTAGACAATTTGGTGAAGCTGTTCCCGTTTTTGAAACCGGTTGTTAAGCTGGAGGTCGTC
AAGACAGTGCTAGAAGCGTATTTACCTCAACTTGCACTTATCTTATTTTTGGCTTTGTTGCCAAAGTTTCTTCTGTTTCTATCCAAAGCAGAGGGCATCC
CATCAGAAAGCCACGTGACAAGAGCTGCTTCAGGGAAATATTTTTATTTCACCGTGTTGAATGTATTTATTGGTGTTACTCTGGGTGGAACTCTATTCAC
TTCCTTCAAGAGCATCGAGCATGATCCCAACTCTATTTTTCGTGTGTTGGCAAAAAAGCCTTCCACAGAATGCAACTTTTTTTCTTGACTTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.968233
Expected error %
0.779202
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g30360.1 Score 232 E Value 2e-61 Identity 15.90% Align. Length 779bp (98.23%) Frame 1
68414.m03712 early-responsive to dehydration stress protein (ERD4) nearly identical to ERD4 protein (early-responsive to dehydration stress) [Arabidopsis thaliana] GI:15375406; contains Pfam profile PF02714: Domain of unknown function DUF221
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g32090.1 Score 124 E Value 6e-29 Identity 10.00% Align. Length 758bp (95.59%) Frame 1
68414.m03949 early-responsive to dehydration protein-related / ERD protein-related similar to ERD4 protein (early-responsive to dehydration stress) [Arabidopsis thaliana] GI:15375406; contains Pfam profile PF02714: Domain of unknown function DUF221
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_506162.1| Score 248 E Value 1e-64 Identity 16.80% Align. Length 779bp (98.23%) Frame 1
PREDICTED OJ1027_G06.13 gene product [Oryza sativa (japonica cultivar-group)] ref|XP_476646.1| putative ERD4 protein [Oryza sativa (japonica cultivar-group)] dbj|BAC82906.1| putative ERD4 protein [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAL34230.1| Score 232 E Value 1e-59 Identity 15.90% Align. Length 779bp (98.23%) Frame 1
unknown protein [Arabidopsis thaliana] gb|AAK59597.1| unknown protein [Arabidopsis thaliana] ref|NP_564354.1| early-responsive to dehydration stress protein (ERD4) [Arabidopsis thaliana] gb|AAG51102.1| unknown protein [Arabidopsis thaliana] pir||H86427 unknown protein [imported] - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0005H23
Clone
Clone name
hba-5h23
LE_HBa0005H23
P005H23
Clone type
BAC
Contamination
none
Estimated length
112,776
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found