Clone Read LE_HBa0078K05_SP6_19304

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0078K05_SP6_19304
Primer
SP6
ID from Seq. Facility
LE_HBa_078_K05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
764 trimmed for vector and quality, 914 raw
Genbank Accession
Sequence
>LE_HBa0078K05_SP6_19304 (raw untrimmed)
GGCCCAGCCTTTCCAAAGTTACAGTTCTGGTTCCTTCCTCCAAAATGCTTCATCTGATGGCTTTTTCCCAGTTACATGTTCCAGTAAGACAACTCCAAAG
CTGTAAACATCTCCTTTGACTGTTGCTTTTCCGGTGTCAAAATATTCTGCAAAAGACCATAATGTAATTGATAGTTTTCCAAACACAGATTCGAGTCTTC
TGATGGTCTAATAAAAACATACCAGGAGCCAAATATCCAAAAGTTCCAGCTACCAAAGTTGAAACGTGCGTCTTATCTGGCTCCATCAGAGTGGCTAGTC
CAAAATCAGATACTCGAGCCTCCATGTTATGACCCAACAAGATATTGCTTGACTTTATATCTCTGTGGATGATGTGAGGGATGCAATCGTGATGTAGATA
TGATAATCCTCTTGCTGCTCCTACTGCTATTTTGTATCTTGTAGGCCAATCCAAAACCTTCCTGGCAGCCGATTTTCCTGCATTATGATGTTACCATTCT
TAAAGTTCATCTGTATATCAAACACTTGATAGGTCTTTATTGTGCATCTCTGATTCTAGCATCAGCAGAAGCTGAAATAAGCTTAAAAGAATGACCATCC
TTAGAGCTATGTTGCTTGGACTCCAAAAAGTACCTCTGTAGGCAAGTCAGGTCCTCCAAAAGTACAGCATTTATGGAGGGTCGGAACATTTTTGAGAGTT
CGAGCAACATAGACTTAGACAATAAGAAACAGACATAAACATATACCATGAAGTGCTTCATCTAAACTTCCATTAGTCATAAGCTCATATATCAGAAGAT
TATACTGCGTTGTACTGTAGTATCCATGAAGTGTCACTATATTTCGATGCTTTATGTCCCCCATTGCCTCCAACTCTCTTTCAAACCTCTGTCTTGTTCG
GCATTATTCCGTTA
>LE_HBa0078K05_SP6_19304 (trimmed for quality and cloning vector)
TGGTTCCTTCCTCCAAAATGCTTCATCTGATGGCTTTTTCCCAGTTACATGTTCCAGTAAGACAACTCCAAAGCTGTAAACATCTCCTTTGACTGTTGCT
TTTCCGGTGTCAAAATATTCTGCAAAAGACCATAATGTAATTGATAGTTTTCCAAACACAGATTCGAGTCTTCTGATGGTCTAATAAAAACATACCAGGA
GCCAAATATCCAAAAGTTCCAGCTACCAAAGTTGAAACGTGCGTCTTATCTGGCTCCATCAGAGTGGCTAGTCCAAAATCAGATACTCGAGCCTCCATGT
TATGACCCAACAAGATATTGCTTGACTTTATATCTCTGTGGATGATGTGAGGGATGCAATCGTGATGTAGATATGATAATCCTCTTGCTGCTCCTACTGC
TATTTTGTATCTTGTAGGCCAATCCAAAACCTTCCTGGCAGCCGATTTTCCTGCATTATGATGTTACCATTCTTAAAGTTCATCTGTATATCAAACACTT
GATAGGTCTTTATTGTGCATCTCTGATTCTAGCATCAGCAGAAGCTGAAATAAGCTTAAAAGAATGACCATCCTTAGAGCTATGTTGCTTGGACTCCAAA
AAGTACCTCTGTAGGCAAGTCAGGTCCTCCAAAAGTACAGCATTTATGGAGGGTCGGAACATTTTTGAGAGTTCGAGCAACATAGACTTAGACAATAAGA
AACAGACATAAACATATACCATGAAGTGCTTCATCTAAACTTCCATTAGTCATAAGCTCATATA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.967152
Expected error %
0.19178
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g78530.1 Score 157 E Value 2e-51 Identity 89.20% Align. Length 429bp (56.15%) Frame 2
68414.m09153 protein kinase family protein contains protein kinase domain, Pfam:PF00069
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g49270.1 Score 123 E Value 1e-28 Identity 22.70% Align. Length 263bp (34.42%) Frame 3
68414.m05524 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD30583.1| Score 157 E Value 7e-50 Identity 89.20% Align. Length 429bp (56.15%) Frame 2
putative protein kinase [Arabidopsis thaliana] ref|NP_177974.1| protein kinase family protein [Arabidopsis thaliana] pir||G96813 hypothetical protein T30F21.14 [imported] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_913664.1| Score 144 E Value 2e-44 Identity 75.00% Align. Length 435bp (56.94%) Frame 2
putative receptor protein kinase [Oryza sativa (japonica cultivar-group)] dbj|BAB18321.1| putative brassinosteroid receptor [Oryza sativa (japonica cultivar-group)] dbj|BAB40081.1| putative receptor protein kinase [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0078K05
Clone
Clone name
hba-78k5
LE_HBa0078K05
P078K05
Clone type
BAC
Contamination
none
Estimated length
78,294
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found