Clone Read LE_HBa0079B04_SP6_19638

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0079B04_SP6_19638
Primer
SP6
ID from Seq. Facility
LE_HBa_079_B04-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
712 trimmed for vector and quality, 829 raw
Genbank Accession
Sequence
>LE_HBa0079B04_SP6_19638 (raw untrimmed)
GGGGTTTCCCCCCCACCTGTGTATCGTTTCGGGGAGAAATGAAAAAATAGAAAGAATAGGAGTTACTCGCCATAATTTTTTTCTTTAAGATGCACCGTCA
CCAAAAAATGGCGCAGGAGACGGAAACTACTCAATTGCACATTCGCCTTAGTCGTCACAATTCACATTTTGGCAACTCCGTTTTCAGCCCATCGCCGAGA
GAATAAATAATAATTTGAAAAGCGCTTCCTCCACGATCTGGTTGCCGGAGGAGGCGATTTTTTGAATGAAGAGTTCACCTGAATTTTCTCGAAATGGCGG
AATCGACGACAATTCAGAGGAGCTCGCCTGAAGGTGATGATCATGAACTGAAGGAGGAGAATATTGAGAAGAAAAAGGATTTTACTGCAAATCCTGAGTT
TTTCAGTTGTATGCTTCAGCCAGTGCCTGCCGATTCAGATCCAAATTACATTGGAATACGCCGGTTCCTCCTCCATCGCAAAGCTGAATCCGGTGTGCTT
CGTCGCAAGGTACGCTTCTTTCACGCATATGTTAGAACACGTGATTATATGTAACTGCGTCATCGCTGTGCGTACGTGTGATTTCTCTTCAGAATCAAAT
GTTAAATACATCCGTGTTGTATGTATTCATTTTTTTTCCTTTTTGATTTACTTATTCATTAATGATATACATACTGGTCTCCTGGTTCAGTCGTATATAG
GATCTCATTATGAACAATTCATTGCTTACTTGGCATGCATTTGTGCCCCTTTCGGTTTATCTAGATTTATTTTTGTGGTTCGTTGTGTAAACTATATGCA
ACTTCCTCCTACATTTTGGATTGGAGGAT
>LE_HBa0079B04_SP6_19638 (trimmed for quality and cloning vector)
GGGGAGAAATGAAAAAATAGAAAGAATAGGAGTTACTCGCCATAATTTTTTTCTTTAAGATGCACCGTCACCAAAAAATGGCGCAGGAGACGGAAACTAC
TCAATTGCACATTCGCCTTAGTCGTCACAATTCACATTTTGGCAACTCCGTTTTCAGCCCATCGCCGAGAGAATAAATAATAATTTGAAAAGCGCTTCCT
CCACGATCTGGTTGCCGGAGGAGGCGATTTTTTGAATGAAGAGTTCACCTGAATTTTCTCGAAATGGCGGAATCGACGACAATTCAGAGGAGCTCGCCTG
AAGGTGATGATCATGAACTGAAGGAGGAGAATATTGAGAAGAAAAAGGATTTTACTGCAAATCCTGAGTTTTTCAGTTGTATGCTTCAGCCAGTGCCTGC
CGATTCAGATCCAAATTACATTGGAATACGCCGGTTCCTCCTCCATCGCAAAGCTGAATCCGGTGTGCTTCGTCGCAAGGTACGCTTCTTTCACGCATAT
GTTAGAACACGTGATTATATGTAACTGCGTCATCGCTGTGCGTACGTGTGATTTCTCTTCAGAATCAAATGTTAAATACATCCGTGTTGTATGTATTCAT
TTTTTTTCCTTTTTGATTTACTTATTCATTAATGATATACATACTGGTCTCCTGGTTCAGTCGTATATAGGATCTCATTATGAACAATTCATTGCTTACT
TGGCATGCATTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.974182
Expected error %
0.201201
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g16405.1 Score 66 E Value 2e-11 Identity 20.10% Align. Length 158bp (22.19%) Frame 1
68415.m01878 transducin family protein / WD-40 repeat family protein contains 7 WD-40 repeats (PF00400); similar to WD-repeat protein 13 (SP:Q9H1Z4) [Homo sapiens]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0079B04
Clone
Clone name
hba-79b4
LE_HBa0079B04
P079B04
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found