Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0079E01_T7_19777

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0079E01_T7_19777
Primer
T7
ID from Seq. Facility
LE_HBa_079_E01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
578 trimmed for vector and quality, 910 raw
Genbank Accession
Sequence
>LE_HBa0079E01_T7_19777 (raw untrimmed)
CTTAACCCGGTCTAGCGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGATTTAGGTTTTTATAGCCTATAGTTTTGGTAGAGTAATGTATATGT
TGTGATCAAGATTCTAGGGTGGATGAAACATGTTTTAGCTATAATGTTTGCTCTCTTTACCTACTTCCCTAAAAGTATATTATTGATAAAATATGATTTT
TTAACAAGACTAGGGAAATTGGTTGATGATCTATGGCTCTCTACTTCCTAGTATATATGTGTATGTATTGTATTAGATTGCAGTATGATCTTGTAGCGAA
TTGTACATGATTTCTTTAATGATTATGGTACATTAGATACTTCCCTATACTTAATTGTTAATGAAATATTATTGGGTCAATGATGACCAAATTCTAAAGA
ATTGGTAAGAATTGCTCTACTCTTCTACTCCTCTATAGAATTGTTGATGAAGCCTTGTATGGCATTGGGTGGTATGGTCCACTAATGGTGTCTGTGTTTA
CTTTATTGTCATTATATATGTGTTTACCATGGAATTGAAGGAAAATTTATGAATATATGAATGTGTGGTTAAGATGATCACCTTATGTGTAAATTGTGCC
TAGTCTTCTACTCTAGTTCCTAAACTAGGTTATGTTACTCTTGCTATGAGCCAGAGAATGTTTATGTAATGTGTAGTTCACGCGCCTACATAAAGTAATC
CTAACAATCACGCTCCCTCTCTGTATCCCCTTGCACCTGCGTTGTTCCTTAGTTCGTAGCCTAATGCAAAGAGAATCTGCTATGCTCCTCTGCATTATCT
GTTGTTTTTACCTCCCTGTCTGCTTAAATTCATTTTACGGGTCTGCTTTCATAGTATTTTCCATCCGCTTACTCTCTCCTCCTTTTCTTCCCCTCTCCCT
TTACCATCTT
>LE_HBa0079E01_T7_19777 (trimmed for quality and cloning vector)
TCTAGAGTCGACCTGCAGGCATGCAAGCTTGATTTAGGTTTTTATAGCCTATAGTTTTGGTAGAGTAATGTATATGTTGTGATCAAGATTCTAGGGTGGA
TGAAACATGTTTTAGCTATAATGTTTGCTCTCTTTACCTACTTCCCTAAAAGTATATTATTGATAAAATATGATTTTTTAACAAGACTAGGGAAATTGGT
TGATGATCTATGGCTCTCTACTTCCTAGTATATATGTGTATGTATTGTATTAGATTGCAGTATGATCTTGTAGCGAATTGTACATGATTTCTTTAATGAT
TATGGTACATTAGATACTTCCCTATACTTAATTGTTAATGAAATATTATTGGGTCAATGATGACCAAATTCTAAAGAATTGGTAAGAATTGCTCTACTCT
TCTACTCCTCTATAGAATTGTTGATGAAGCCTTGTATGGCATTGGGTGGTATGGTCCACTAATGGTGTCTGTGTTTACTTTATTGTCATTATATATGTGT
TTACCATGGAATTGAAGGAAAATTTATGAATATATGAATGTGTGGTTAAGATGATCACCTTATGTGTAAATTGTGCCT

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.914715
Expected error %
0.175339
Sequence Annotations 
Automatic Annotations
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|X65306.2:1-103 Score 64 E Value 2e-11 Identity 100.00% Align. Length 31bp (5.36%) Frame 2
Cloning vector pGEM-3Zf(+)
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|L08952.1:1-181 Score 62 E Value 6e-11 Identity 100.00% Align. Length 30bp (5.19%) Frame 2
pT7T319 cloning vector
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0079E01
Clone
Clone name
hba-79e1
LE_HBa0079E01
P079E01
Clone type
BAC
Contamination
none
Estimated length
124,249
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found