Clone Read LE_HBa0079E24_T7_19823

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0079E24_T7_19823
Primer
T7
ID from Seq. Facility
LE_HBa_079_E24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
414 trimmed for vector and quality, 867 raw
Genbank Accession
Sequence
>LE_HBa0079E24_T7_19823 (raw untrimmed)
AGCCCGGGCCCGGGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGAGGATTTTACCGAAATTTGCCGCTACTGCTGGATGGAGAAGAGAGGG
GGCATCGTTAGGCAGATGCTGTCCATTTGGCGCTGCATTATTTTACCGGCGCCGATGTTGCTGCTGGAGTCGCTGTCAATTGCGTGCATCCATTGCTGGT
GATTGCTTGCTGCTGCCTGGAAGCTCGTCTGAGTGCTGCCAGTGATGGAAATAAGAAGGCGGAGAAGAGAGGAAGAAATGGACAGAGAAGAGGAGAGAGG
AGAGGGTGGCGCCGTGCTTCTAGTCATGGCCTGCTGCTGCTGTTGCGCGAGACTGCTGCTGCATGGAGCCGTCGCTGGTCGCTGGTCTCTGGAAAAAGAA
GAAGAAAATAAAAGAGAAGAAGAAGGGGAAGACAAAAGGAGAAAGGGGGGGGGGGAGGAAANANGANANNNNNNNNNNANGANNANNNNNANNAAANNAA
AAAAAAAAAAAAANAAAANAAAAAAAAAAAAAAAAAAAAAAAANAAAAAAAANAAAAAAANAAAAAAAAAAAAAAAAAAAAAANAANNNAAAAAAAAAAA
NAAAAAAAAAAAAAAAAAAAAAAAAAANNAAAAAAANAAAAAAAAAAAANAAAANAAAANANNNAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANANAAA
AAAAAAAAAAAAAAAANAAAAAAAAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAANNAAAAAAAAAAAAAGAAAAAAAAANAAAAAAAANAAAAAAAAAAAAAAA
>LE_HBa0079E24_T7_19823 (trimmed for quality and cloning vector)
AGCTTTGAGGATTTTACCGAAATTTGCCGCTACTGCTGGATGGAGAAGAGAGGGGGCATCGTTAGGCAGATGCTGTCCATTTGGCGCTGCATTATTTTAC
CGGCGCCGATGTTGCTGCTGGAGTCGCTGTCAATTGCGTGCATCCATTGCTGGTGATTGCTTGCTGCTGCCTGGAAGCTCGTCTGAGTGCTGCCAGTGAT
GGAAATAAGAAGGCGGAGAAGAGAGGAAGAAATGGACAGAGAAGAGGAGAGAGGAGAGGGTGGCGCCGTGCTTCTAGTCATGGCCTGCTGCTGCTGTTGC
GCGAGACTGCTGCTGCATGGAGCCGTCGCTGGTCGCTGGTCTCTGGAAAAAGAAGAAGAAAATAAAAGAGAAGAAGAAGGGGAAGACAAAAGGAGAAAGG
GGGGGGGGGAGGAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.933179
Expected error %
0.00294603
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0079E24
Clone
Clone name
hba-79e24
LE_HBa0079E24
P079E24
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found