Clone Read LE_HBa0079F11_T7_19845

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0079F11_T7_19845
Primer
T7
ID from Seq. Facility
LE_HBa_079_F11-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
813 trimmed for vector and quality, 957 raw
Genbank Accession
Sequence
>LE_HBa0079F11_T7_19845 (raw untrimmed)
CCAAACTGGGTCCCGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGAATAAAAATGTCGCTGAGGTTATTTCTACAGTAAATTCCGTACGGG
ATTGACCTCAACTCCATTGAGTTCTGTGATTGACTTTGATCAGTTATACTTCTCAATTGAAGTGTAAGTTTGAGTATATCAGTGTACTGATAATGTACTT
ATTTCTTTCTTGTTGAGTGAAAGAATCTTCCAACTACTGATCCAATATATCAGCTGATAAACATATGATTCTGAGTCCAAGGAAGATCTTATTCGTTTTG
GCTTTCATGAATTCTTTAGTTTCTTATACATTTGTTCAGACACAGGCCATATACTTATTCATAATTAGCTTTCGGGGTTGCACCCCTAGTGTCACATCCC
AGGAGCACCCCCTAAACATAATCGGTGGCTACGTCCTTGGAGAGGACTAAGACTAGCCTCTTAGCATTCATCATTTCATTTATAGGTTAAAACGCGGAAA
ATTTAAAACTTTTCAACTACATTTATATCATGAGGCTTACATAGACCTCTCACATTACACATAGTATATTAATAGTGAGTTTACTTAGAGCTTTTGTATA
AGAAGCTTACATAGTCTTCTACTTTTATGTCACACATATATATAAGATACACATCCTAGTCTTAATATAGATATCTCATATTAAACCATCTAAATGGAAT
AGAACAATATGGGTGTATCCCTTACACAAATGTAGAAAGGCCACTTANGGCTTACAATAATATCTTGAGAAAACATGAGTGAAATGATTGTCTTTAGGCT
ATAACAATGTACCACAGGTAGAGTGAGAAAAAGCATCATTCTCAGACATGAGGACATACCCAACCTCCAAGGATTATCTAAGCCTTGCTGGCAATGGTCC
CAAACCTTTCAACAATCGGAACTTAAAATTGGGGAAAGGGAAAATAGGGGTTACACT
>LE_HBa0079F11_T7_19845 (trimmed for quality and cloning vector)
AGCTTTGAATAAAAATGTCGCTGAGGTTATTTCTACAGTAAATTCCGTACGGGATTGACCTCAACTCCATTGAGTTCTGTGATTGACTTTGATCAGTTAT
ACTTCTCAATTGAAGTGTAAGTTTGAGTATATCAGTGTACTGATAATGTACTTATTTCTTTCTTGTTGAGTGAAAGAATCTTCCAACTACTGATCCAATA
TATCAGCTGATAAACATATGATTCTGAGTCCAAGGAAGATCTTATTCGTTTTGGCTTTCATGAATTCTTTAGTTTCTTATACATTTGTTCAGACACAGGC
CATATACTTATTCATAATTAGCTTTCGGGGTTGCACCCCTAGTGTCACATCCCAGGAGCACCCCCTAAACATAATCGGTGGCTACGTCCTTGGAGAGGAC
TAAGACTAGCCTCTTAGCATTCATCATTTCATTTATAGGTTAAAACGCGGAAAATTTAAAACTTTTCAACTACATTTATATCATGAGGCTTACATAGACC
TCTCACATTACACATAGTATATTAATAGTGAGTTTACTTAGAGCTTTTGTATAAGAAGCTTACATAGTCTTCTACTTTTATGTCACACATATATATAAGA
TACACATCCTAGTCTTAATATAGATATCTCATATTAAACCATCTAAATGGAATAGAACAATATGGGTGTATCCCTTACACAAATGTAGAAAGGCCACTTA
NGGCTTACAATAATATCTTGAGAAAACATGAGTGAAATGATTGTCTTTAGGCTATAACAATGTACCACAGGTAGAGTGAGAAAAAGCATCATTCTCAGAC
ATGAGGACATACC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.959686
Expected error %
0.842611
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0079F11
Clone
Clone name
hba-79f11
LE_HBa0079F11
P079F11
Clone type
BAC
Contamination
none
Estimated length
117,473
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found